Ethics statement
All procedures strictly conformed to the Ethics Committee and Experimental Animal Ethics Committee of the First Hospital of Jilin University. Written informed consents were obtained from all participants before the study. The animal experiments were strictly conformed to the principle of minimizing the pain, suffering and discomfort to the experimental animals.
Microarray-based analysis
The Gene Expression Omnibus (GEO) database was applied in retrieving microarray data related to osteosarcoma. The “limma” package was employed for the differential analysis and |logFC| > 2 and p-value < 0.05 were selected as the threshold for screening differentially expressed genes. The expression location of PGM5-AS1 was predicted using the lncATLAS database (http://lncatlas.crg.eu/) and the downstream miRNA activity of PGM5-AS1 was predicted using the RAID database (https://www.baidu.com/baidu?&ie=utf-8&word=ncbi%20geo). The TargetScan database (http://www.targetscan.org/vert_71/), mirDIP database (http://ophid.utoronto.ca/mirDIP/index.jsp#r), miRDB database (http://mirdb.org/miRDB/index.html), and miRmap database (https://mirmap.ezlab.org/) were used to predict the downstream target gene of miR-140-5p.
Tissue specimen samples
The osteosarcoma tissue samples were collected from 73 patients with detailed clinical data who were pathologically diagnosed as osteosarcoma and underwent surgical resection in the First Hospital of Jilin University from January 2013 to December 2015. The patients did not receive chemoradiotherapy before the surgery. There were 41 males and 32 females and the age of the patients ranged from 9 to 53 years with an average age of 26.68 ± 13.50. Among these patients, 33 patients were aged ≤ 20 years old and 40 patients were aged > 20 years old; 38 patients’ tumor diameter was ≤ 5 cm while 35 patients were > 5 cm. Besides, the adjacent normal bone tissues that locate 4 cm away from the osteosarcoma tissues were also collected from these patients [14, 15].
Follow-up
We followed up the patients suffering from osteosarcoma via phone or return visit till December 2018 and also observed the overall survival rate of these patients. As of December 2018, 7 patients were lost to follow-up, the follow-up rate was 90.41%, and the follow-up duration was 5–36 months.
RNA in situ hybridization
The 463 bp DNA fragment (corresponding to nucleotide position 142–585 bp of PGM5-AS1) was cloned into the pSPT19 vector (10999644001, Sigma, Shanghai, China) and the antisense RNA probe was synthesized using the DIG RNA Labeling Kit (SP6/T7; 11175025910, Sigma, Shanghai, China). The DNA fragment sequence of PGM5-AS1-ISH was as follows: F, GATCGGAATTCCGGGTAAGAGAATGTCCGAAAG; R, GATGCAAGCTTCACCATGCTGTGCTGTAGAT. The double DIG-labeled LNA microRNA probe (QIAGEN, Shanghai, China) for miR-140-5p was incubated with the paraffin-embedded osteosarcoma tissue sections. Briefly, after being deparaffinized, the tissue sections were treated with proteinase K (Roche, Basel, Switzerland), hybridized with 300 ng/mL probe at 60℃ for 16 h, then incubated with anti-digoxygenin-AP (AP-conjugated Fab fragments) (11093274910, Roche, Basel, Switzerland) at 25℃ for1 h, and lastly added with BM Purple (11442074001, Roche, Basel, Switzerland) for color reaction [16–18].
Cell culture and treatment
A normal cell line hFOB 1.19 (CBP60724; Culture Medium: Dulbecco's modified eagle's medium [DMEM]: F12 + 0.3 mg/mL G418 + 10% fetal bovine serum [FBS]) and five cell lines related to osteosarcoma: U2OS (CBP60238; Culture Medium: McCoy's 5a + 10% FBS), SaOS-2 (CBP60742; Culture Medium: McCoy's 5a + 15% FBS), MG63 (CBP60233; Culture Medium: MEM + 10% FBS), HOS (CBP60787; Culture Medium: RPMI-1640 Medium + 10% FBS), and SJSA1 (CBP60236; Culture Medium: RPMI-1640 + 10% FBS) were purchased from Cobioer Biotechnology Co., Ltd. (Nanjing, China).
Osteosarcoma cells were plated into a 6-well plate with 3 × 105 cells in each well. Upon cell confluence was approximately 50%, sh-negative control (NC), sh-PGM5-AS1-1, sh-PGM5-AS1-2, inhibitor NC, miR-140-5p inhibitor, mimic NC, miR-140-5p mimic, or sh-FBN1 were delivered into the cells in accordance with the protocols of Lipofectamine 2000 (11668-019, Invitrogen, New York, California, USA). The mimic NC, miR-140-5p mimic, inhibitor NC, and miR-140-5p inhibitor were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). Table 1 displays the sequences of shRNAs.
Table 1
Item | Sequence | Company |
sh-PGM5-AS1-1 | GGGTAAGAGAATGTCCGAAAG | Thermo Fisher |
sh-PGM5-AS1-2 | GGTAAGAGAATGTCCGAAAGA | Thermo Fisher |
sh-FBN1 | GCATGCACTTACGGATTTACT | Thermo Fisher |
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
The Trizol kit (16096020, Thermo Fisher Scientific, California, USA) was employed to extract the total RNA. Five µg RNA was reversely transcribed into complementary DNA (cDNA) in conformity to the protocols of the cDNA kit (K1622, Fermentas Inc., Ontario, CA, USA). RT-qPCR was carried out with the TaqMan MicroRNA Assay and TaqMan® Universal PCR Master Mix on the basis of the guidelines of TaqMan Gene Expression Assays (Applied Biosystems, Foster City, CA, USA) [19]. U6 was selected as the internal control for miR-140-5p, while glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected for PGM5-AS1 and FBN1. Table 2 shows the sequences of primers. The 2−ΔΔCt method was employed to calculate the relative expression of the target genes.
Table 2
Primer sequences used in reverse transcription quantitative polymerase chain reaction
Gene | Primer sequence (5' − 3') |
PGM5-AS1 | F: GCCCTGCCTTCAGCCTCCTCA |
R: GAAACGTCGGCCTGGCCTTGT |
FBN1 | F: GGGTCAAAGATCACGTGCACAG |
R: TTGTCAAAGCAGACGGAGGTC |
miR-140-5p | F: TGCGGCAGTGGTTTTACCCTATG |
R: CCAGTGCAGGGTCCGAGGT |
U6 | F: GCTTCGGCAGCACATATACTAAAAT |
R: CGCTTCACGAATTTGCGTGTCAT |
GAPDH | F: ATGGAGAAGGCTGGGGCTC |
R: AAGTTGTCATGGATGACCTTG |
Western blot assay
The bicinchoninic acid protein assay kit (Thermo Fisher Scientific, California, USA) was used to extract the total protein, followed by measurement of protein concentration. Totally, after polyacrylamide gel electrophoresis, 30 µg proteins were transferred onto the polyvinylidene fluoride membrane (Amersham Healthcare, Chicago, Illinois, United States). After that, the membrane was sealed by 5% non-fat milk at room temperature for 1 h, followed by cultivation at 4 °C overnight in rabbit polyclonal antibodies against FBN1 (ab231094, 1 : 1000), E-cadherin (ab15148, 1 : 500), N-cadherin (ab76057, 1 : 1000), Vimentin (ab137321, 1 : 2000), and GAPDH (ab9485, 1 : 2500). All antibodies were provided by the Abcam Inc. (Cambridge, UK). The membrane was then incubated with secondary antibody to goat anti-rabbit immunoglobulin G (IgG) H&L (ab6721, 1 : 3000, Abcam Inc., Cambridge, UK) marked by horseradish peroxidase (HRP) at room temperature for 1 h. After being scanned and developed under the chemiluminescence instrument (Gel Company, San Francisco, CA, USA). The relative protein expression was analyzed using Image Pro Plus 6.0 (Media Cybernetics, MD, USA).
Transwell assay
Migration detection: Osteosarcoma cells in logarithmic growth stage were starved for 24 h until the final concentration of cells reached 2 × 105 cells/mL. Subsequently, the apical chamber was added with 0.2 mL of cell suspension and the basolateral chamber was added with 700 µL pre-cooled DMEM supplemented with 10% FBS. And then, the chambers were cultivated at 37℃ with 5% CO2 for 24 h. After being fixed with methanol for 30 min, the cells were subjected to 0.1% crystal violet staining for 20 min, and were observed under the inverted microscope. Five visual fields were randomly selected and the number of transmembrane cells was counted.
Invasion detection: The extracellular matrix (ECM) gel was diluted using serum-free culture medium at 1 : 9 till the final concentration was 1 mg/mL. The polycarbonate membrane in the 24-well apical chamber was supplemented with 40 µL ECM gel and then further cultivated at 37℃ with 5% CO2 for 5 h till the ECM gel was polymerized. An amount of 70 µL of pure DMEM was then added to the ECM gel and further incubated at 37℃ for 0.5 h to hydrate the ECM gel. The starved osteosarcoma cells in serum for 24 h were resuspended with FBS-free DMEM until the final concentration reached 2.5 × 105 cells/mL. Then, the hydrated basement membrane of apical chamber was added with 0.2 mL of cell suspension and the basolateral chamber was added with 700 µL of pre-cooled DMEM conjugated with 10% FBS. The chambers were then cultivated under the conditions of 37℃ with 5%CO2 for 24 h. After being fixed with methanol for 30 min, the cells were subjected to 0.1% crystal violet staining for 20 min, and observation under the inverted microscope. We randomly selected 5 visual fields to count the number of cells that passed through the membranes.
Fluorescence in situ hybridization (FISH)
FISH was conducted in accordance with the protocols of RiboTM lncRNA FISH probe Mix (Red) (Guangzhou RiboBio Co., Ltd., Guangzhou, Guangdong China) in order to identify the subcellular location of PGM5-AS1 in osteosarcoma cells. The osteosarcoma cells were plated onto the slide in a 6-well plate, followed by 1-h culture till the cell confluence was 80% or so. After being fixed with 1 mL 4% paraformaldehyde, the cells were manipulated with protease K (2 µg/mL), glycine, and acetylation reagent, and then incubated with 250 µL pre-hybridization. After the pre-hybridization removal, the cells were hybridized overnight with 250 µL hybridization solution supplemented with 300 ng/mL probe. The cells were then observed under the fluorescence microscope (Olympus Optical, Tokyo, Japan).
Fractionation of nuclear/cytoplasmic RNA
The osteosarcoma cells were resuspended with Hypotonic Buffer A (10 mM HEPES [pH = 7.5], 0.5 mM DTT, 10 mM KCl, 1.5 mM MgCl2) containing protease inhibitor and RNase inhibitor (N8080119, Thermo Fisher Scientific, Thermo Fisher Scientific, California, USA), followed by incubation on ice for 10 min and centrifugation under the conditions of 1000 g at 4℃ for 10 min. The supernatant was collected and centrifuged at 15000 g for 15 min to collect the cytoplasm. The precipitate was washed with hypotonic buffer, and resuspended with Hypotonic Buffer B (10 mM HEPES [pH = 7.5], 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 0.5% Nonidet P-40) and Radioimmunoprecipitation Assay Buffer (50 mM Tris HCl [pH = 7.5], 1500 mM KCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mM ethylenediaminetetraacetic acid, pH = 8.0). The precipitate was centrifuged at 15000 g for 20 min to collect the supernatant, which contained the nucleus.
RNA pull-down assay
In conformity to the guidelines of the Lipofectamine 2000, the cells were manipulated with 100 pmol Bio-miR-140-5p or NC. After 48 of transduction, the cells were resuspended in 0.7 mL lysis buffer (5 mM MgCl2, 100 mM KCl, 20 mM Tris [pH = 7.5], 0.3% NP-40, 50 U of RNase OUT [Invitrogen, Carlsbad, CA, USA], complete protease suppressor cocktail [Roche Applied Science, Indianapolis, IN, USA]). The cells were then centrifuged at 10000 g for 10 min to separate the cell lysate. RNA pull-down assay of miRNA was performed based on the previously published method [20, 21]. The expression of PGM5-AS1 in Bio-miR-140-5p or NC was detected using RT-qPCR.
RNA immunoprecipitation (RIP) assay
The interaction among miR-140-5p, PGM5-AS1 and FBN1 was identified using the RIP assay kit (Millipore Inc., Bedford, MA, USA). After being lysed with lysis buffer (P0013B, Beyotime Biotechnology Co., Shanghai, China), the cells were subjected to centrifugation at 35068 g at 4℃ for 10 min to collect the supernatant. A big section of cell extraction was taken as the Input and the rest section was cultured with the antibody for co-precipitation as follows: 50 µL magnetic beads were resuspended in 100 µL RIP Wash Buffer and cultured with 5 µg antibody. The complex of bead and antibody was then resuspended using 900 µL RIP Wash Buffer, followed by incubation in 100 µL cell extraction overnight at 4℃. The samples were then placed on the magnetic base to collect the beads-protein complex. The antibodies used for the RIP assay were argonaute 2 (Ago2, ab32381, 1 : 50, Abcam Inc., Cambridge, UK) and IgG (1 : 100, ab109489, Abcam Inc., Cambridge, UK) was used as the NC.
Dual-luciferase reporter gene assay
The whole length of FBN1 3’UTR was amplified. The RT-qPCR products were cloned into the polyclonal sites of the downstream gene of pmirGLO (Promega, Madison, WI, USA) using the endonuclease sites Spe I and Hind III to construct the FBN1-wild type (WT) vector. The target gene prediction database including TargetScan, mirDIP, miRDB, and miRmap databases were used to predict the binding site between miR-140-5p and its target. FBN1-mutant type (MUT) vector was constructed via site-directed mutagenesis. Using renilla luciferase expression vector pRL-TK (TaKaRa Biotechnology Co. Ltd, Liaoning China) as the internal control, the plasmids were co-transfected with luciferase reporter vectors into HEK-293T cells. The Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) was employed in measuring the activity of luciferase.
Xenograft tumor in nude mice
Twenty-four female BALB/c nude mice with an age of 3–4 weeks and a weight ranging from 14–18 g were housed under the conditions of constant temperature (25℃ − 27℃) and constant humidity (45% − 50%). sh-NC or sh-PGM5-AS1 was delivered to osteosarcoma cell line U2OS and the nude mice were subcutaneously injected with 20 µL of cell suspension. The tumor volume was recorded every 6 days and calculated as follows: tumor volume = a × b2/2 (a, the maximum diameter; b, the minimum diameter). We also drew a curve of the tumor growth. Thirty days after injection, the nude mice were euthanized and the tumors were isolated from the mice and weighed. RT-qPCR and western blot analysis were carried out to detect the levels of PGM5-AS1, FBN1, miR-140-5p, and epithelial-mesenchymal transition (EMT)-related genes in tumor tissues.
Statistical analysis
The SPSS 21.0 software (IBM Corp. Armonk, NY, USA) was applied in data analysis. The measurement data were presented as mean ± standard deviation. The pair-designed data between two groups conforming to normal distribution and homogeneity of variance were analyzed using paired t-test. One-way analysis of variance (ANOVA), along with Tukey’s post-hoc test was used for comparison of data among multiple groups. Repeated measurement ANOVA, together with Bonferroni’s post-hoc test, was conducted to analyze the data at different time points. The Kaplan-Meier method was adopted to construct the overall survival curve and log-rank was used for analysis of the survival differences. Analysis of the enumeration data were performed using the Chi-square test. A value of p < 0.05 indicated that the difference was in statistical significance.