Plant material and experimental design
In order to test if water stress can be used as a priming factor for improving avocado tolerance to R. necatrix, a ‘cross-factor priming’ experiment was carried out in 2017 at the Institute of Agricultural Research and Training (IFAPA) (Málaga, south-eastern Spain, 36° 40' 25'' N, 04° 30' 11'' W, elevation of 32 m below sea level). One hundred and twelve 2-year old clonal ‘Dusa’ plants (Westfalia Estate, South Africa) propagated by Brokaw nursery (Brokaw España S.L.) using a modified Frohlich method [106], were grown in 16L pots containing a sterilised mixture of organic substrate and sand supplemented with a slow-release fertiliser (Basacote Plus 6M, Compo Expert GmbH).
‘Dusa’ plants were kept in a greenhouse under day light illumination and semi-controlled conditions of air temperature (T) and relative humidity (RH). Photosynthetic photon flux density (PPFD), T and RH conditions inside the greenhouse were continuously registered by a quantum sensor (Apogee SQ-110, USA) and by a T/RH U23–001 HOBO® Pro v2 logger (Onset Computer Corporation, USA). Maximal midday values of PPFD varied between 440 and 1012 mmol m−2 s−1, and daily T was allowed to fluctuate according to external weather conditions, but its variation range inside the greenhouse was maintained between 20±10 °C by an automatic cooling system and heating when necessary. The RH values inside the greenhouse were always over 40%.
The experimental design is depicted in Fig. 1. At the beginning of the experiment (t0), plant physiological status was tested non-destructively by measuring chlorophyll fluorescence at predawn. Plants were randomly distributed in rows into two sets of 56 plants to conduct two trials. For each trial, 18 plants were randomly assigned to a control group, in which soil moisture was maintained at field capacity (Fc) throughout the experimentation, and two sets of 19 plants were subjected to controlled substrate drying-up until they reached 50% of Fc (i.e. mild water stress, mild-WS) and 25% of Fc (i.e. severe water stress, severe-WS), respectively. Once these soil water content levels were attained (after ~16–17 days; t1), full irrigation was restored in all plants and drought recovery response was assessed one week after re-watering (i.e. after ~23–24 days; t2). Hereinafter, the term ‘primed plants’ refers to plants subjected to each of the water stress levels followed by a recovery period. The pathogenicity test with R. necatrix was performed at t2 as described below.
Soil moisture was monitored in all plants with a wet sensor (HH2 Moisture meter, Delta-T Devices. Cambridge, England), previously calibrated for the substrate, which also allowed adjustment of volumetric soil moisture (v/v) for each water treatment (mild-WS and severe-WS) in relation to the soil water holding at field capacity (Fc~0.4 v/v). Once per week plants were fertilised with an NPK solution (Kristalon Blue 17–6–18, Yara, UK) supplemented with iron chelate (Sequestrene®, Syngenta, Spain).
Throughout the experiment, physiological measurements and root samplings were carried out at t1 and t2. On each trial, 15 plants per treatment were measured at each sampling point. Roots were sampled from 9 plants per treatment not used for the pathogenicity test.
Physiological measurements
Midday (12:00–14:00 am) leaf water potential was measured at t1 (when mild-WS and severe-WS plants reached 50% and 25% of Fc) and at t2 (one week after re-watering) using a Schölander pressure chamber (model 3005; Soil Moisture Equipment Corporation, Santa Barbara, CA, USA). On each trial, 15 plants per treatment were measured at each sampling point. Measurements were done in one mature fully developed leaf per plant close to the main stem. After cutting, leaves were immediately placed in the chamber following the recommendations made by Hsiao [107].
Relative leaf water content (RWC), the specific leaf mass area (LMA) and relative chlorophyll content (SPAD index) were measured only at t1 in the same plants as for leaf water potential determinations. For RWC determinations, leaf discs (2 cm2) were sampled at midday, weighed to obtain fresh weight (FW) and immediately imbibed on distilled water for 24 h at 5 °C in darkness for obtaining turgid weight (TW). Afterwards, samples were oven dried at 80 °C for 48h to get dry weight (DW). RWC was calculated as follows:
RWC (%) = [(FW – DW) / (TW – DW)] x 100
The specific leaf mass area (LMA) was calculated as the ratio between disc dry weight and disc area (g cm-2).
The SPAD index was non-destructively measured at midday on one leaf per plant using a hand-held SPAD 502 meter (Minolta, Osaka, Japan). This index provides an estimation of leaf chlorophyll content consistent with leaf greenness [108]. For each plant, averaged SPAD values were calculated from three readings per leaf.
In vivo chlorophyll a fluorescence signals were measured with a portable fluorometer PAM-2100 (Heinz Walz, Effeltrich, Germany) at predawn (at t0) and midday (at t1 and t2) in one leaf per plant. The so-called saturation pulse method was used to determine all fluorescence parameters [109]. Dark-adapted parameters (i.e. minimal fluorescence (F0), maximal fluorescence (Fm) and maximal photochemical efficiency of PSII (Fv/Fm=[Fm−F0]/Fm) were determined at predawn (05:00–07:00 am). The steady-state fluorescence (Ft), maximal fluorescence (Fm’) and minimal fluorescence yield of a pre-illuminated sample (F0’) were assessed in light acclimated leaves (∼450 µmol quanta m−2s−1). The relative quantum yield of PSII photochemistry (ΦPSII=[Fm’−Ft]/Fm’) [110], the fraction of PSII centres in open state (qL) [47] and the extent of “Stern-Volmer” non-photo-chemical fluorescence quenching (NPQ=[Fm−Fm’]/[Fm’]) [111] were calculated.
Leaf gas exchange was measured at midday (11:00–14:00 am) at t1 and t2 in one mature exposed leaf. Measurements were performed with an open portable photosynthesis system (model LI-6400, LI-COR, USA) equipped with a LED-light source (6400–02B), coupled to a sensor head/IRGA, and with a CO2 mixer (6400–01) to modify the incoming air’s CO2 concentrations. The operating flow rate was 500 mL min–1 and CO2 partial pressure was 400 ppm. Saturating photosynthetic photon flux density (1000 µmol m–2 s–1) was chosen as the default condition. Leaf temperature was kept at ∼20 °C and relative humidity was adjusted to 50% (vapor pressure deficit ∼1.4 kPa). Net CO2 assimilation rates (AN) and stomatal conductance (gs) were estimated with the equations of Von Caemmerer and Farquhar [112].
RNA extraction
Roots from 9 avocado plants from control, mild-WS and severe-WS were harvested at t1 and t2 in plants others than those used in the pathogenicity test. Three biological replicates were used for RNA extraction. Each replicate consisted in a bulk sample from three plants. RNA from ground root tissue was extracted using the CTAB extraction method [113], a simple and efficient method for isolating RNA from pine trees with slight modification. The chloroform:isoamyl alcohol step was repeated 3–5 times, depending on the stability of the interphase and colour of the sample. RNA quantity and quality were determined based on A260/280 and A260/230 wavelength ratios using a NanoDrop® ND-1000 (Nanodrop Technologies, Inc., Montchanin, USA) spectrophotometer. RNA integrity was confirmed by the appearance of ribosomal RNA bands and lack of degradation products after separation on a 2% agarose gel and Red Safe staining. DNase treatment of RNA was performed by the addition of 1 U RNase-free DNase (Thermo Scientific, Life Technologies Inc., Carlsbad, California, USA), 1 μL 10x reaction buffer with MgCl2, 1 μg RNA, 0.5 μL of RiboLock RNase Inhibitor (Thermo Scientific Inc., California, USA) and diethylpyrocarbonate-treated water to a final volume of 10 μL. The mixture was incubated at 37 °C for 45 min followed by the addition 1 μL of 50 mM EDTA and incubation at 65 °C for 10 min.
Quantitative Real-Time PCR
Single stranded cDNA was synthesized using iScript Reverse Transcription Supermix (Bio-Rad Laboratories Inc., California, USA) according to manufacturer's instructions. The cDNA was analysed for genomic DNA contamination by PCR using gene specific primers F3H-F (5‘–TCTGATTTCGGAGATGACTCGC–3‘) and F3H-R (5‘–TGTAGACTTGGGCCACCTCTTT–3‘), which flank an intron of the eflavone 3-hydroxylase (F3H) gene. PCR amplifications were carried out as previously described by Engelbrecht and van den Berg [48] using first-strand cDNA as the template.
The expression of thirteen avocado genes was investigated based on previous literature. The actin gene was used as endogenous control for normalization. Primer sequences for endogenous control gene and the thirteen avocado genes are presented in Table S1. Primer pairs were chosen to generate fragments between 70 to 140 bp and were designed using Primer 3 software (http://bioinfo.ut.ee/primer3–0.4.0/, [114, 115]). Primer specificity was tested by first performing a conventional PCR and confirmed by the presence of a single melting curve during qRT-PCR. Serial dilutions (1:10, 1:20, 1:50, 1:200) were made from a pool of cDNA from each treatment and time-points, and calibration curves were performed for each gene. For qRT-PCR, the reaction mixture consisted of cDNA first-strand template, primers (500 nmol final concentration) and SYBR Green Master Mix (SsoAdvanced Universal SYBR Green Supermix, Bio-Rad) in a total volume of 20 µl. The PCR conditions were as follows: 30 s at 95 °C, followed by 40 cycles of 15 s at 95 °C and 30 s at 60 °C, 3 min at 72 °C, 1 min at 95 °C. The reactions were performed using an iQ5 real-time PCR detection system (Bio-Rad). Relative quantification of the expression levels for the target was analysed using the DDCt method [116]. All reactions were done in triplicate.
Pathogenicity test in avocado plants
Inoculum was produced on wheat seeds according to Sztejnberg and Madar [117]. Briefly, seeds were soaked for 12 h in 250 ml Erlenmeyer flasks filled with distilled water. The flasks, each containing 100 g of seeds, were subsequently autoclaved after excess water drained off. After sterilisation, four 0.5 cm diameter fungal discs of a 2-week-old culture of R. necatrix grown on potato dextrose agar (PDA) were placed aseptically in each flask and incubated at 24 °C in the dark for three weeks until wheat grains were homogeneously covered by R. necatrix mycelium. Seven days after re-watering (t2), ‘Dusa’ rootstocks from each treatment (control n=9, mild-WS n=10, severe-WS n=10) on each of the two trials, were inoculated with 3.75 g of colonized wheat seeds per litter of substrate. To ensure the spread of the inoculum, it was placed at eight points scattered around the stem (~3.5 cm apart) and introduced at two depths (~5 cm and ~15 cm, respectively). Disease progression was evaluated by measuring the aerial symptoms of WRR according to a scale: 1= healthy plant; 2= mild wilting; 3= wilting; 4=desiccated; and 5= death. The disease index (DI) for each treatment and the area under the disease progress curve (AUDPC) was calculated as previously described by Teixeira de Sousa [118] and Campbell and Madden [119], respectively.
Statistical analysis
Data were analysed using the analytical software STATISTICA 7 (StatSoft, Inc., USA). Differences among treatments in physiological variables and AUDPC were evaluated by analysis of variance (ANOVA). On each sampling point, datasets obtained from the two trials were subjected to a two-way ANOVA, in which ‘trial’ and ‘treatment’ were the between-subjects factors. This analysis allowed to test whether the variability observed between the two trials was significantly different or not, and to what extent was it possible to merge datasets for performing a unique one-way ANOVA for each sampling point. Since no significant effect of ‘trial’ was observed in any of the variables analysed, data from the two trials were analysed jointly. Therefore, data depicted in the figures for each treatment are average values of the measurements taken in the two trials. Significant differences were considered at the 5% probability level unless otherwise stated. Prior to ANOVA, normality and homogeneity assumptions were tested by using the Kolmogorov–Smirnov and the Cochran's C test, respectively. When significant differences were found, Fisher's least significant difference (LSD) test was used to compare mean values. Statistical analysis of qRT-PCR data was carried out by Student's t-test with Sigma Stat version 4.0 software (Systat Software GmbH).