Cell culture
SMMC-7721 cell line was obtained from Cell Bank of the Chinese Academy of Science (Shanghai, China). Cells grew at 37℃ in 5% CO2 atmosphere in DMEM medium (Gibco) containing 10% fetal bovine serum, as well as 100 IU/ml penicillin and 100 µg/mL streptomycin. Cells in the logarithmic growth phase were used for the subsequent experiments.
Knockdown of HSF4
Two shRNA against HSF4 were used to knock down HSF4 expression. The target sequence was: Sh1: CCGGCCAACTCAACATGTACGGTTTCTCGAGAAACCGTACATGTTGAGTTGGTTTTT; sh2: CCGGCATCTCTGACATCCCAGAAGACTCGAGTCTTCTGGGATGTCAGAGATGTTTTTTG. shRNA was cloned into lentiviral vector pLKO.1, and were co-transfected into 293T cells with lentivirus packaging vectors using Lipofectamine 3000. 48 hours after transfection, lentiviral particles were harvested and used for cell transfection. HSF4 stably knocking down cells were achieved by screening with puromycin for 2 weeks.
Cell proliferation
Cells were seeded into 96-well plate for proliferation assay using Cell Counting kit-8. Colony formation assay were carried out by seeding 6000 single cells into 6 cm dish, and staining with Crystal Violet Staining Solution for further observation.
Wound scratching assays
Nearly 500000 cells were seeded in 6-well plates. After forming confluent monolayer, cells were scratched using Pipette tips and washed to remove cell debris. Wound healing was observed right after scratch, as well as after 24 hours growth in serum-free DMEM medium.
Spheroid Colony Formation Assay
7721 cells, cultured as monolayer, were harvested as single cell suspension and resuspended in tumor sphere medium (serum-free DMEM/F12 medium supplemented with 2% B27, as well as 20 ng/ml human recombinant basic fibroblast growth factor (bFGF, PeproTech) and 20 ng/ml human recombinant epidermal growth factor (EGF, Millipore)). Cells were then seeded in ultra-low attachment 96-well plates (Corning) at a density of 400 cells per well. After two weeks, spheroid colonies in each well were counted using light microscope.
qRT-PCR
Trizol reagent was utilized to extract the total RNA of cultured cell lines and tissue samples according to the manufacture’s protocol. PrimeScript RT Reagent Kit (TaKaRa) and SYBR Premix Ex Taq (TaKaRa) were used to detect mRNA expression level following the manufacturer’s instructions. The primers for qRT-PCR were summarized in table 1.
Table 1: Sequence of the primers used in qPCR.
|
Forward Primer (5' -> 3')
|
Reverse Primer (5' -> 3')
|
HSF4
|
GCCTTCCTCGGCAAGCTATG
|
AAACGGCTCTGGTCGCTTAC
|
SOX2
|
GCCGAGTGGAAACTTTTGTCG
|
GGCAGCGTGTACTTATCCTTCT
|
NANOG
|
TTTGTGGGCCTGAAGAAAACT
|
AGGGCTGTCCTGAATAAGCAG
|
CD44
|
CTGCCGCTTTGCAGGTGTA
|
CATTGTGGGCAAGGTGCTATT
|
OCT4
|
GAGTGAGAGGCAACCTGGAGAAT
|
ACCGAGGAGTACAGTGCAGTGAA
|
Western blot
Antibody against CD44, GAPDH were obtained from Abcam, and antibodies against OCT4, Nanog, SOX2 and HSF4 was purchased from Santa Cruz Biotechnology. Western blotting analysis were carried out as previously described1.
Immunofluorescence staining
Adherent cells: Washed with PBS for three times after removing the culture medium. Then it was incubated with CD44 antibody labeled with FITC (Bioligand) at 4 ℃ for 1 hour. After being washed for three times, it was observed under inverted fluorescent microscope.
Tumor sphere cells: Tumor spheres were collected in 1.5 ml centrifugal tube, and incubated with CD44 antibody labeled with FITC (Bioligand) at 4 ℃ for 1 hour. After being washed for three times, tumor spheres were resuspended. Drop the suspension on the slide and observe under inverted fluorescent microscope.
Co-expression analysis of HSF4 and stemness-associated genes
Co-expression relationship between HSF4 and stemness-associated genes in liver cancer was analyzed using CHIP Base V2.0 online database (http://rna.sysu.edu.cn/chipbase/index.php).
Evaluation of prognostic value of HSF4 using Online KM plotter database
Online KM plotter database (http://kmplot.com/analysis) were used to evaluate the prognostic value of individual HSF mRNA expression for overall survival (OS) in liver cancer.
Statistical analysis
Data was shown as Mean + SD, calculated by the two-tailed Student’s T test (graph pad software). Differences were regarded significant when p < 0.05.