Field-plot experiment
A three-year field-plot experiment was conducted in 2009-2011 in Tomaszkowo (N: 53° 42', E: 20° 22') in north-eastern Poland. Plots were sown with winter wheat cv. Bogatka (Danko Plant Breeding in Chorynia, Poland, https://www.danko.pl/odmiany/bogatka). Two crop protection strategies for protecting crops against Zymoseptoria tritici, the most dangerous pathogen of wheat leaves in Europe, were analyzed (Table 1). Fungicides Bumper 250 EC (Fung 1, propiconazole) and Fandango 200 EC (Fung 3, commercial mixture of fluoxastrobin and propiconazole) were applied in first node at least 1 cm above tillering (BBCH 31) [68] and fungicides Alert 375SC (Fung 2, commercial mixture of flusilazole and carbendazim) and Soprano 125SC (Fung 4, epoxiconazole) were applied in the heading stage (BBCH 55) in the doses specified in Table 1. Plot size was 20 m2, and the experiment had a random block design with four replications. Plots sprayed with 400 l/ha of water were the control.
Wheat leaves were sampled six times during the growing season, including three times after every fungicide treatment: after 24 hours, 10 days and 20 days. The third fully developed topmost leaf was sampled from each plant. Leaf segments with a length of 1 cm were cut out at a distance of 2 cm from the leaf base. The width of leaf segments was measured.
Yeast isolation and identification
Yeasts were isolated immediately after leaf sampling. Microorganisms were isolated from 15 1-cm-long leaf segments that were surface disinfected by immersion in 1% sodium hypochlorite for 1 minute and macerated in a mortar with 1 cm3 of sterile water. The second microbial dilution of the suspension in the amount of 0.1 cm3 was collected from the mortar and was pour-plated on Martin agar [69]. The experiment was performed in three replications. Yeast were incubated for 7 days in darkness at a temperature of 24°C. The colonies were counted and expressed per 1 cm2 of leaf area based on leaf width and 10-2 dilution. Randomly selected yeast colonies with a varied morphology were isolated from plates. They were pour plated on potato dextrose agar (PDA, Merck, Poland) with the addition of kanamycin (A&A Biotechnology, Poland) and streptomycin (Sigma, Poland). For short-term storage at a temperature of 4°C, yeast isolates and the substrate were placed in 1.5 cm3 Eppendorf tubes protected with sterile oil. For long-term storage at -80°C, yeast isolates were placed in cryogenic vials (Biomaxima, Poland).
Yeast isolates were identified based on morphological features, the size of budding cells, pseudofilaments and chlamydospores under a microscope at 400 x magnification (Nikon 200 E, Japan) according to the available keys and monographs [70, 71]. A total of 75 yeast isolates were isolated for further analyses (Table 2).
Yeast DNA was isolated with the DNA Genomic Mini AX YEAST Kit (A&A Biotechnology, Poland). The fragment with ITS 1, 5.8S and ITS 2 rDNA regions was amplified with specific ITS5 (F) GTATCGGACGGAGATCCAGC and ITS4 (R) TTGCTCAGTGCATTGTCGG primers [72] with the FailSafe PCR Kit (Epicentre, Poland). The PCR reaction was performed on 20 ng of DNA in the Mastercycler Ep Gradient thermal cycler (Eppendorf, USA). The reaction had the following thermal profile: 3 minutes at 95°C, followed by 34 cycles of: 1 minute at 95°C, 1 minute at 58°C, 3 minutes at 74°C and 10 minutes at 74°C. PCR amplicons with 0.5 µg/ml of ethidium bromide were subjected to electrophoresis in 1% agarose gel (Prona NU Micropor, Poland) in TBE buffer (Blirt S.A., Poland). Electrophoresis separation products were visualized with a transilluminator (MultiDoc-It, USA). Amplicons were sequenced by the Institute of Biophysics and Biochemistry of the Polish Academy of Sciences in Warsaw (www.ibb.waw.pl). The similarities between sequences were determined with NCBI BLAST (National Center for Biotechnology Information, Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Fungicide toxicity for yeast isolates in the disk diffusion test
Seventy-five yeast isolates were spread plated on PDA in Petri plates, including 47 isolates of A. pullulans, 18 isolates of Rh. glutinis, 6 isolates of Cryptococcus sp., 2 isolates of D. hansenii and 1 isolate of C. albicans and Pseudozyma sp. each. Paper discs (Biomaxima, Poland) with a diameter of 5 mm were saturated with propiconazole, epoxiconazole, the flusilazole and carbendazim mixture and the fluoxastrobin and prothioconazole mixture, and were plated [73]. The tested fungicides were applied at 1, 10, 100 µl dm-3 water based on the concentration of the active ingredient. The size of the inhibition zone was measured after 4 days in the ImageJ 1.48p program [74]. The results were presented as the area of the inhibition zone in square millimeters. The isolates were divided into three groups based on their sensitivity to fungicides. Non-sensitive (NS) isolates did not produce inhibition zones around paper discs saturated with fungicides. The inhibition zones formed by sensitive (S) isolates had an area of 1 to 250 mm2, whereas highly sensitive (HS) isolates produced inhibition zones with an area larger than 250 mm2.
Yeasts ability to biodegrade propiconazole
Yeast isolates that were not sensitive to propiconazole in the disk diffusion test were exposed to this fungicide in a liquid medium. Suspensions of 16 yeast isolates (1 cm3 each) with cell density of 108 were placed in 15 cm3 flasks (Bionovo, Poland) containing 9 cm3 of a liquid medium (beef extract – 1 gram, soy peptone – 5 grams, NaCl – 5 grams, glucose – 1 gram, yeast extract – 7 grams dm-3 water). Propiconazole was added to the flasks in the following amounts: 100, 200, 300, 400 and 500 µl dm-3. After 48 hours of incubation at 24°C, 100 µl of every yeast suspension was pour plated on PDA. Flasks without propiconazole were the control. The experiment was performed in three replications.
Seven yeast isolates obtained from wheat leaves, non-sensitive to fungicides, were selected for the propiconazole biodegradation test: Rh. glutinis Rg 55, Rh. glutinis Rg 92, A. pullulans 203, Cryptococcus sp. 48, Cryptococcus sp. C 123, A. pullulans 83 and A. pullulans 137 (Table 2). The tested isolates were cultured in 10 cm3 of water with the addition of 2 mg dm3 of propiconazole (Sigma, Poland) for 48 hours at a temperature of 27°C. The microorganisms were centrifuged (8000 rpm, 5 minutes), and propiconazole residues were extracted and analyzed by HPLC [61] in the Agilent Technologies 1200 Series HPLC System (USA) with a diode array detector. The analysis was performed in isocratic elution mode with a mixture of acetonitrile and water (80/20, v/v) acidified with 0.15% formic acid as the eluent, at a flow rate of 0.5 cm3 /min. Chromatographic separation was performed on the Agilent Eclipse XDB-C18 column (150 mm × 4.6 mm, 5 µm) at 30°C. Chromatographic data were registered at 220 nm wavelength for 11 minutes. Data were acquired and analyzed based on the calibration curve for the propiconazole standard in the HP ChemStation program. The experiment was conducted in two replications.
Application of yeasts to decrease propiconazole's toxic effects on wheat seedlings
The seeds of winter wheat cv. Bogatka dressed with three yeast isolates were sown in pots with a diameter of 12 cm, filled with 160 grams of sterile soil (autoclaved twice at 121°C and 1.2 atm), in a greenhouse. Seeds were dressed with Cryptococcus sp. C 123, Rh. glutinis Rg 55 and Rh. glutinis Rg 92 isolates which most effectively degrade propiconazole. Seeds were dressed by immersion in a yeast suspension of 106 cells cm-3 water for 30 minutes. Germinated seeds were watered every 48 hours with the Hoagland solution containing macronutrients and micronutrients [75], in the amount of 30 cm3 per pot, throughout the experiment. After 14 days, seedlings were treated with the Bumper 250EC fungicide at a concentration 50-fold higher than that recommended by the manufacturer (6.25% solution in 20 cm3 of water per pot). Plants watered only with the Hoagland solution (Control) and fungicide-treated plants growing from seeds that were not treated with the yeast suspension (Control F) were the control. The experiment was conducted in four replications. The fungicide's phytotoxic effects were evaluated after two weeks. Symptoms of leaf chlorosis were evaluated on a 5-point scale: 0 points – no chlorosis, 1 point – chlorosis affecting 10% of leaf area, 2 points – chlorosis affecting 10-30% of leaf area, 3 – chlorosis affecting 30-50% of leaf area, 4 points – chlorosis affecting 50-90% of leaf area, 5 points – chlorosis affecting more than 90% of leaf area. The dry matter content of seedlings was determined.
Statistical analysis
The results were processed using the Statistica 13.0 (2016) software package (Statistica 13.0 [76] software). Yeast colony counts were log transformed (CFU+1), and the results were presented as log(CFU+1) per 1 cm2 of leaf. The data were subjected to analysis of variance (ANOVA), and the significance of differences between mean values was determined by the Student-Newman-Keuls (SNK) test. The size of inhibition zones in the diffusion test was expressed in mm2. The significance of differences between the mean areas of inhibition zones was determined by the Student-Newman-Keuls (SNK) test. The percentage of isolates of yeast species with varied sensitivity to the tested agrochemicals was presented as heat maps for each product [77].