WY195 promoter type
Using the ATMT method, GUS was stably expressed when regulated by WY195 (Fig. 5). PCR and Southern blot demonstrated that WY195 was successfully transformed into N. tabacum (Fig. 6) and regulated the expression of the GUS gene. However, GUS staining was not observed in the tissues or organs of the T1 generation of transgenic tobacco plants. Therefore, we concluded that WY195 is not a constitutive promoter or a organ/ tissue-specific promoter but an inducible promoter.
PlantCARE analysis revealed that the WY195 sequence comprised nine copies of the TATA-box, five copies of the CAAT-box, a wound-responsive element, three elements related to the light response, one cis-acting regulatory element essential for anaerobic induction, one MYB cis-acting regulatory element, one binding site involved in drought-inducibility, and three cis-elements, the functions of which were unclear (Table 2).
Table 2
Sequence analysis of suspected promoter WY195 by PLANTCARE
Cis-acting regulatory elements | Organism | Position | Strand | Sequence | Function |
TATA-box | Arabidopsis thaliana Helianthus annuus Glycine max Lycopersicon esculentum Arabidopsis thaliana Arabidopsis thaliana Lycopersicon esculentum Brassica napus Arabidopsis thaliana | 87 223 132 227 129 225 197 128 130 | + - + - - + + + - | TATA TATACA TAATA TTTTA TATAA TATAAA TTTTA ATTATA TATA | Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start Core promoter element around − 30 of transcription start |
CAAT-box | Arabidopsis thaliana Brassica rapa Arabidopsis thaliana Hordeum vulgare Hordeum vulgare | 2 232 214 3 215 | + + + + + | CCAAT CAAAT CCAAT CAAT CAAT | Common cis-acting element in promoter and enhancer regions Common cis-acting element in promoter and enhancer regions Common cis-acting element in promoter and enhancer regions Common cis-acting element in promoter and enhancer regions Common cis-acting element in promoter and enhancer regions |
WUN-motif | Brassica oleracea | 177 | + | TCATTACGAA | Wound-responsive element |
Chs-CMAla | Daucus carota | 109 | - | TTACTTAA | Part of a light responsive element |
Box Ⅰ | Pisum sativum | 92 | - | TTTCAAA | Light responsive element |
ARE | Zea mays | 153 | - | TGGTTT | Cis-acting Regulatory element essential for the anaerobic induction |
ATCT-motif | Arabidopsis thaliana | 36 | + | AATCTAATCT | Part of a conserved DNA module involved in light Respinsiveness |
MBS | Arabidopsis thaliana | 219 | + | CAACTG | MYB binding site involved in drought-inducibility |
Unnamed_1 | Zea mays | 101 | + | CGTGG | |
Unnamed_3 | Zae mays | 101 | + | CGTGG | |
Unnamed_4 | Petroselinum hortense | 190 | + | CTCC | |
(Line 171) |
Based on the sequence analysis results, anaerobic induction, wound induction, strong light induction, and drought induction experiments were performed on the T1 generation of transgenic tobacco. On the other hand, due to the presence of cis-acting elements of unknown function in WY195, temperature induction, which is very common in the induction type, has also been carried out. GUS activity was detected in plants subjected to high temperature and drought conditions (Fig. 7), and not detected in plants subjected under other induced conditions.
WY195 regulated expression of hpaXm in tobacco
Using the ATMT method, hpaXm was stably expressed when regulated by WY195 (Fig. 8). The presence of hpaXm and WY195 in the T1 generation was verified by PCR. (Fig. 9a). The WY195 primer amplified a band of the same size as WY195, which was about 250 bp. The hpaXm primer was amplified with hpaXm, generating the expected band of approximately 400 bp. The integration of the target genes was confirmed by Southern blot analysis (Fig. 9b). PCR products amplified in the transgenic T1 generation were hybridized with corresponding probes targeting WY195 and hpaXm to produce two unique bands of the corresponding size. This indicated that WY195 and hpaXm genes had been smoothly integrated into the genome of N. tabacum.
Soluble proteins produced by WY195- hpaXm transgenic tobacco elicited HR on tobacco leaves
Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel patterns and bioactivity of soluble proteins from leaves of WY195-hpaXm transgenic tobacco, induced WY195-hpaXm transgenic tobacco, pBI121-hpaXm transgenic tobacco and N. tabacum wild type were compared. The molecular mass of hpaXm was estimated to be 13.3 kDa, and the putative GST–hpaXm protein was about 35 kDa [54]. The results suggested that the purified protein from the induced WY195-hpaXm transgenic tobacco was abundant among total proteins and had the same size as hpaXm from E. coli (Fig. 10). Same size protein as hpaXm were not obtained for uninduced WY195-hpaXm transgenic lines. Only proteins from induced WY195-hpaXm transgenic tobacco and pBI121-hpaXm transgenic tobacco were active, and the degree of protein-induced HR from the induced WY195-hpaXm transgenic tobacco was significantly stronger than that of the protein from pBI121-hpaXm transgenic tobacco and hpaXm prepared periodically from recombinant E. coli strain (Fig. 11), even though the proteins were boiled for 10 min. Instead, proteins isolated from uninduced WY195-hpaXm transgenic tobacco, pBI121 transgenic tobacco or N. tabacum wild type did not cause the HR (Fig. 11). It demonstrated that hpaXm was actively present in leaf tissues of induced WY195-hpaXm transgenic tobacco.
Defensive responses were induced in WY195- hpaXm transgenic tobacco
The T1 generation WY195-hpaXm transgenic tobacco was observed to determine whether defensive responses had been induced. As a result, no visible HR or micro-HR was induced on its leaf surface. However, dark blue micro-HR of scattered necrotic cell clusters were observed under the microscope after trypan blue staining, which significantly more severe than pBI121-hpaXm transgenic tobacoo (positive control). And micro-HR was not induced in the N. tabacum wild type (negative control) (Fig. 12). The results showed that the expression of hpaXm which regulated by WY195 promoter produced defensive responses with partial hypersensitive cell death in transgenic tobacco leaves, and it is more severe than that in pBI121-hpaXm transgenic tobacco.
TMV resistance of WY195- hpaXm transgenic tobacco
First, the T1 generation WY195-hpaXm transgenic tobacc is induced correspondly, then challenged with TMV rub inoculation. As a result, hpaXm transgenic tobacco had significant TMV resistance compared to wild-type three-smoke (Fig. 13). The number of TMV lesions observed on wild-type N. tabacum after inoculation with TMV was significantly higher than that of the positive control 35S-hpaXm and WY195-hpaXm transgenic T1 plants (P ≤ 0.01; Table 3). Compared with wild-type N. tabacum, the average number of lesions observed on the positive control group was approximately 29.37% lower. Compared with wild-type tobacco and the positive control, the average number of lesions observed on the WY195-hpaXm transgenic T1 plants was approximately 66.44% and 52.48% lower, respectively.
Table 3 Resistance levels of WY195-hpaXm transgenic tabacco against TMV
Plants | Plant leaf lesion number (X ± SE) | P ≤ 0.01 Significance level | Lesion reduction/ % |
N. tabacum wild type | 47.67 ± 1.43 | A | |
T1 generation of 35S-hpaXm transgenic tobacco | 33.67 ± 2.33 | B | 29.37 |
T1 generation of WY195-hpaXm transgenic tobacco | 16.00 ± 2.31 | C | 66.44 |
Preliminary analysis of the full length of WY195 by a series of deletion mutations
PROMO predicted that when the fault tolerance rate is set to the default of 15%, 558 transcription factors are obtained for WY195Q. However, this data is too cumbersome to analysis, and the error rate itself is higher. Thus, the fault tolerance rate was reduced to zero, and 103 transcription factors were obtained. The 103 transcription factors were searched in the online non-redundant database JASPAR of the TFBS, and all databases of all species were selected. A total of 27 previously reported TFBS were retrieved. These 27 TFBS with known functions were marked on the WY195Q sequence (Fig. 14). Series deletion mutations of WY195Q were performed after avoiding the destruction of these TFBS. The plant expression vector pBI121-WY195Q, pBI121-WY195Q1, pBI121-WY195Q2 and pBI121-WY195Q3 were constructed for sequence WY195Q (2100 bp), WY195Q1 (1829 bp), WY195Q2 (1321 bp) and WY195Q3 (830 bp) (Table 4, Fig. 15a, Fig. 15b). The level of transient expression of the GUS gene regulated by these sequences in tobacco was measured by qRT-PCR (Fig. 15c). Among them, WY195Q2 regulates the highest expression of GUS gene. Thus the WY195 full length was preliminary analysed as 1321 bp.
Table 4
Primers for WY195Q series deletion mutation
Fragments | Upstream primers | Downstream primers |
WY195Q | 195QF: CCCAAGCTTTGTATCTCGAGATCGTTTTTT | CGCGGATCCTCTGCATGCTAGTGATTTGT |
WY195Q1 | 195Q1F: CCCAAGCTTTTCTTCACCTAATTTTCGTCAGTCC |
WY195Q2 | 195Q2F: CCCAAGCTTCCAGGCTTAGAATATTATTTATG |
WY195Q3 | 195Q3F: CCCAAGCTTTCTAAGACGACATGTAATTATCC |
WY195 | 195F: CCCAAGCTTAACCAATAATTTTCACGAGGG |
(Line 247) |