Regents and cell lines
The monoclonal antibody to human QTRT1 was purchased from Santa Cruz Biotechnology (Dallas, TX). Monoclonal antibody of β-catenin and E-cadherin from BD Transduction (San Jose, CA), and β-actin were purchased from Sigma-Aldrich (St. Louis, MO). Monoclonal antibody of PCNA and CD11b (Integrin αM) were purchased from Santa Cruz Biotechnology (Dallas, TX). Claudin 5 and Claudin 2 mouse monoclonal antibody and ZO-1 rabbit monoclonal antibody were purchased from Thermo Fisher Scientific (Rockford, IL). CD68 rabbit polyclonal antibody was purchased from Abcam (Cambridge, MA). All chemicals were purchased from Sigma-Aldrich unless otherwise stated. The breast cancer cell lines, including MCF7 and MDA-MB-231, were provided by Dr. Tao Pan’s lab at University of Chicago.
Transfection and selection
The highly aggressive breast cancer cell line human MCF7 cells were cultured in a 6-well tissue culture plate in antibiotic-free MCF7 cells growth medium (Eagle's Minimum Essential Medium with 10% FBS, 10ug/ml bovine insulin, 10nM β-estradiol) (Invitrogen, Carlsbad, CA) to 70-80% confluence. Cells were transfected with 2µg of QTRT1 Double Nickase Plasmid (sc-413456-NIC), 10µl LTX Lipofectamine and 2.5ul PLUS Reagent (Invitrogen) per well (manufacturer’s protocol). QTRT1 Double Nickase Plasmid-derived puromycin-resistance gene was used for positive selection of transfected cells. Cells were selected with 1 µg/ml puromycin for 5 days when further cell death was not observed. After selection, cells were collected, and serial diluted onto four 96-well plates. Single cells were expanded to obtain individual clones. The culture of MDA-MB-231 cells was as described before[45], and transfection and selection were as described above.
Clone validation
Individual clones after expansion to 6-well plate format were collected for clone validation. Cells were lysed in CelLytic™ M, Lysis Reagent (Sigma-Aldrich) with protease inhibitor cocktail (ThermoFisher) overnight at 4°C. The lysate was centrifuged at 16,000 g for 30 min and 10 µg of supernatant was fractioned on 4-20% SDS PAGE gels, transferred to nitrocellulose, and screened by Western Blot with QTRT1 Antibody (Santa Cruz; sc-398918). Antibody (Santa Cruz; sc-398918) is specific for amino acids 111-136, exon 3 and a 5’ fragment of exon 4: QTRT1Genomic DNA was isolated from edited clones and nonedited MCF7 control cells with DNAzol method (ThermoFisher) and tested with PCR using QTRT1-specific primers in exon 1 (F1: 5’ end of the exon1: GGCGGGAGCAGCTACCCA) and intron downstream of exon 3 (Rev1_3: intron downstream of the exon 3: CCCGGCCTCAAGTGATCTTC). The clone validation of MD-MB-231 cells was performed as described above.
Cell Proliferation Assay
The WT and QTRT1 KO MCF7 cells were plated in a density of 1×104 cells per well in triplicate. After two days of culture, the proliferation was evaluated by MTT Cell Proliferation Assay Kit (Thermo Fisher Scientific, Rockford, IL) according to the product’s instructions [45]. Triplicate wells were counted for each time point and the whole experiment was repeated three times. The evaluation of proliferation of WT MDA-MB-231 and QTRT1-KD (knockdown) MDA-MB-231 cells was performed as described above using MTT Cell Proliferation Assay Kit.
Wound Healing Assay
Both wild type (WT) and QTRT1-KO of MCF7 were plated on dishes (MatTek, Ashland, MA) and cultured in humidified chambers with 5% CO2 at 37°C. When Cells were grown to confluency, the wounds were scratched and analyzed as described before [45]. Migration of cells into wounded areas was captured at per day. The values are the means of three independent wound fields from three independent experiments (n = 3). As described above, the wound healing assay was also performed on the WT and QTRT1-KD MDA-MB-231 cells.
In vivo nude mice model
The 8-week old, specific-pathogen-free, female BALB/c Nude mice (n=40) were purchased from Charles River Laboratories (Wilmington, MA). Animals were housed in Biologic Resources Laboratory (BRL) at University of Illinois at Chicago (UIC) and utilized in accordance with the UIC Animal Care Committee (ACC) and Office of Animal Care and Institutional Biosafety (OACIB) guidelines. The same and consistent diet was provided to the animals throughout the experiment. The animals were separated as two groups including mice for MCF7-WT cell injection (n=20) and mice for QTRT1-KO MCF7 cell injection (n=20). The xenograft model was established by subcutaneous bilaterally injecting with 1.2×106 cells in 200 µl of 50:50 Matrigel / PBS (phosphate buffered saline) into the hind flank [46]. At 60 days post-tumor challenge, tumors and samples were harvested from the animals which were euthanased by IP injection of sodium pentobarbital (100mg per kg body weight) followed by cervical dislocation. The weight of the tumors was scaled, and the tumor volume (V) was calculated with caliper measurements using formulas V = (W2 × L) / 2 [47]. BrdU staining was performed as previously described [48]. Protein expression in tumor tissues was detected by immunofluorescence staining and western blot as described below. Wildtype and QTRT1-KD MDA-MB-231 cells (7.5×106) were also performed using the BALB/c Nude mice (n=40) as described above, except that the tumors and samples were harvested at 30-day post cell injection.
Western blot analysis
Breast tissue was lysed in stocked lysis buffer [45]. Cultured cells were rinsed twice in ice-cold Hanks’ balanced salt solution (Sigma-Aldrich, Saint Louis, MO) and lysed in protein loading buffer then followed by sonication (Branson Sonifier, Danbury, CT) and centrifugation [45]. The target proteins were detected by special primary antibody (1:1,000) followed by secondary antibody conjugated to horseradish peroxidase at 1:5,000 dilution. The blots were visualized by ECL chemiluminescence (Thermo Scientific, Rockford, IL). All experiments were performed 3-5 times. Western blot bands were quantified using image analyzer (ImageJ, NIH, Bethesda, MD).
Immunofluorescence and confocal Imaging
Wildtype and knockout/knockdown cells were plated on fibronectin-coated glass coverslips and cultured with medium described above to monolayer in humidified chambers with 5% CO2 at 37°C. The cells were immunostained and imaged as described before [45]. All experiments were performed multiple times using independent biological replicates.
Fresh tumors were fixed in 10% neutral buffered formalin followed by paraffin embedding. For immunofluorescence staining [49], slides were incubated in 5% BSA (Bovine Serum Albumin) with 0.1% goat serum in PBS for 1 hour at room temperature to reduce nonspecific background. The samples were incubated overnight at 4°C with primary antibody at 1:100 dilution. The sections were then incubated with secondary antibodies and DAPI for 1 hour at room temperature, and examined with confocal microscope as described before [50].
For fluorescence in situ hybridization [4] staining, fresh tumor tissue was fixed with 10% neutral buffered formalin and embedded in paraffin. The sections were treated successively with 0.2 M HCl, 1M NaSCN and 4% pepsin, then hybridized with the EUB338 probe (5′-GCTGCCTCCCGTAGGAGT-3′) for all bacteria and Bfi826 (5'-ATGGCACCCAACACCTAG-3') for Butyrivibrio fibrisolvens-related clones[51] in hybridization buffer (0.9 M NaCl, 0.02 M Tris-HCl, pH 7.6, 0.01% sodium dodecyl sulfate) at 37°C overnight. Slides were then incubated for 10 min with FISH washing buffer (0.3M NaCl, 0.03 M Trisodium citrate) preheated to 45°C. Slides were imaged using confocal microscope as described above. All experiments were performed 3-5 times.
Immunohistochemistry
Tissues were fixed in 10% neutral buffered formaldehyde for 2 hours, transferred into 70% ethanol, and processed the next day by standard techniques. Immunohistochemistry for inflammation cells was performed on paraffin-embedded sections (4 µm) of tumors. Briefly, the paraffin sections were baked in an oven at 56°C for 30 minutes. The sides were deparaffinized and rehydrated in xylene, followed by graded ethanol washes at room temperature. Antigen retrieval was achieved by boiling the slides in the microwave oven with 0.01 M, PH 6.0 sodium citrate buffer. Sides were then incubated in hydrogen peroxide (3% H2O2 in PBS) for 10 minutes at room temperature, followed by incubation in 5% fetal bovine serum/PBS for 1 hour. The inflammation cells were stained with polyclonal CD68 antibody (abcam, Cambridge, MA) and monoclonal CD11b antibody (Santa Cruz, Dallas, TX).
Luminex immunoassays
The 26 cytokines and chemokines of plasma samples were analyzed using the mouse cytokine and chemokine magnetic 26-ple ProcartalPlex Panel 1 (Thermo Fisher Scientific, Waltham, MA) with 25µl of samples according to the manufacturer’s instructions using a 2 hours incubation at room temperature. Samples were read on a MAGPIXTM system platform (Millipore Sigma, Burlington, MA).
Microbial sampling and sequencing
The day before the cell injection, fresh feces were collected directly from the mouse into the sterile tubes. At the end of the experiment, fresh fecal samples were isolated from the colon and placed into the specially prepared sterile tubes. The samples were kept at low temperature with dry ice and were sent to the UIC RRC (University of Illinois at Chicago Research Resources Center) for genomic sequencing. The DNAs of samples were extracted using DNeasy Power Fecal Kit (Qiagen, Hilden, Germany) based on manufacturer’s instructions with a slight modification. The samples were heated at 65°C for 10 min before homogenizing with FastPre-24 5G bead-beating device (MP Biomedicals, Solon, OH) at 6 m/s for 40 seconds. The workflow for preparing samples for next-generation amplicon sequencing contains two independent PCR steps. The first stage PCR amplification was performed using primers containing CS1 and CS2 linkers (CS1_341F: 5’-ACACTGACGACATGGTTCTACAGTGCCAGCMGCCGCGGTAA-3’; CS2_806R: 5’-TACGGTAGCAGAGACTTGGTCTGGACTACHVGGGTWTCTAAT-3’) to the V3-V4 variable region of the 16S rRNA gene, while the second stage PCR amplification was performed on the first stage PCR products using the Fluidigm Access Array barcoded primers. The 16S rRNA gene metagenomic sequencing was performed using MiSeq according to the Illumina protocol.
Sequencing bioinformatics
All possible raw paired-end reads were evaluated and merged using the PEAR (Paired-End reAd mergeR) software (http://www.exelixis-lab.org/web/software/pear.) [52]. Ambiguous nucleotides were trimmed from the ends and reads with internal ambiguous nucleotides were discarded. Filter-passed reads were used for further analysis after trimming off both primer and adapter sequences based on quality threshold (P=0.01) and length (minimum length=225). Chimeric sequences were identified using the USEARCH (http://www.drive5.com/usearch) algorithm as compared with the reference database silva_132_16S.97 [53]. Then, operational taxonomic unit (OTU) clusters were generated using the UCLUST (http://www.drive5.com) method with a threshold of 97% sequence similarity. Taxonomic annotation of each OTU was made via searching by similarity against the references which were identified using the USEARCH (http://www.drive5.com/usearch) algorithm as compared with a reference database [54].
Initially, 1,314,538 reads were assembled from the source sequencing data. After trimming, the number of reads were diminished to 1,290,241, and then after chimera checking reduced to 1,211,340 which was used as the operational OTUs in the alignment. The OTUs were ranged from 54,043 to 65,772 for the individual sample, with a mean of 60,567. The taxonomic assignments of the microbiomes of the studied samples were obtained with the OTU data. On the phylum level, Bacteroidetes and Firmicutes accounted for the major part of the microbial population in all samples (96.4%-99.4%).
Statistical analysis
Data shown in the bar figures were the average values from at least three independent experiments with the Mean ± SD. All statistical tests were two-sides. It was considered statistically significant with P-value < 0.05. One, two and three asterisks on the bars in the figures represent P-value < 0.05, < 0.01, and < 0.001, respectively. To investigate the dynamic effects of QTRT1-KO/KD on cell migration in breast cancer cells, the group effects from 1 to 9 days (Figure 2a, Figure S2f) were tested using generalized linear mixed models.
The alpha and beta diversity indices including Shannon diversity, Chao1 richness and Bray-Curtis dissimilarity were calculated. The “core” bacteria were defined as the set of species shared by (almost) all individuals with 0.1% relative abundance in more than 50% of the samples. Bar plot and heatmap were used to visualize the identified core bacteria. Principal coordinate analysis (PCoA) plots were used for the visualization of Bray-Curtis dissimilarity [55]. To detect the differences of Bray-Curtis dissimilarity among groups, PERMANOVA was performed, followed by a variance homogeneity assumption testing to ensure the reliability of the PERMANOVA results. Then a nonparametric procedure analysis of similarity (ANOSIM) based on a permutation test was used for analyzing among-and-within group similarity. The latest version R and R packages of ampvis2, microbiome, phyloseq and vegan were used for microbiome data analyses[56, 57].
The statistical analyses were performed using SAS version 9.4 (SAS Institute, Inc. Cary, NC), GraphPad Prism 5 (GraphPad Software, Inc. La Jolla, CA).