Animals
As described below, a resident-intruder paradigm, where Sprague Dawley intruder rats were exposed to social stress by dominant Long Evans resident rats; one hour each day for seven consecutive days, was used to study stress-induced changes in the HPA-axis and the immune system. Each of the ten male Long Evans rats (500 – 550 g) was housed with a female Long Evans rat (200 - 250 g) (Envigo; USA) in a 0.56 m2 cage. The ten male Sprague Dawley rats (300 – 400 g) used as intruders were housed in pairs, as were the ten male Sprague Dawley rats (300 – 400 g) used as controls (Janvier Labs; France). The different strains were kept in separate rooms. All rats were acclimatized to a 12:12hr light: dark cycle, ventilation rate of 15 x air per hour, 21 – 22 oC and 45 – 55 % humidity. At all times, the rats had ad libitum access to food and water. Bedding was changed once a week. All animal procedures were approved by the Norwegian Food Safety Authority and performed in conformity with laws and regulations controlling experiments and procedures on live animals in Norway.
Screening
To ensure dominant behavior of Long Evan males i.e., the resident rats in the paradigm, a screening was performed prior to the stress-conditioning week. Top ten aggressive rats were chosen based on the highest incidences of attacks over a period of 10 minutes.
Resident-intruder paradigm
First, the female rat was temporarily removed from the resident cage one hour before the stress conditioning. Next, the stress conditioning was performed by introducing the intruder animal into the resident cage. The male resident and intruder rat were separated upon three episodes of social defeat (submissive supine posture, freeze or flight), or after 10 minutes of interaction by a perforated plastic wall, allowing the intruder rat to still see, smell and hear the resident rat. Finally, after 60 minutes in the resident cage, the intruder rat was returned to its home cage, and the female rat was returned to the resident cage. The conditioning procedure described above was repeated for 7 days. To prevent habituation to the dominance establishment with the resident rat, the intruder animals were introduced to a new resident animal every day. The control animals followed the same procedure except that they visited a foreign cage without a resident rat.
Social interaction test
A modified version of the social interaction test was used to assess social interaction behavior of the Sprague Dawley rats (i.e., the test rats) following one week of stress or control conditioning [30]. The test arena was a purpose made box (0.56 m2) divided into three compartments by two gated plastic walls and a small wire-like container in each flanking compartment. The test rats were allowed to habituate in the center compartment for four minutes (supplementary fig. 1A) before a novel rat of the same strain was placed into one of the small wire-like containers (supplementary fig. 1B). The subsequent opening of the gates allowed the test rat to move freely between the compartments for six minutes (supplementary fig. 1C). Movement and behavior of the test animals were recorded by a camera placed in a rack above the box. Thus, changes in behavior were examined after the experiments, including the time spent in each chamber and the time spent in direct social interaction with the novel rat. The novel rats were habituated to the wire-like container prior to the social interaction test, but did not take part in the resident-intruder paradigm.
Video analysis
Recorded videotapes of rats moving in the three-chamber box were analyzed using a purpose-made software program, which was programmed and developed in C. The time spent in each of the three chambers and locomotion of rats (10 sec intervals) were scored by the software.
Anesthesia and blood sampling
Following the social interaction test and one hour rest in their home cage, on day 8, the intruder Sprague Dawley and control rats were sedated with 5 % isoflurane in air in a gas box prior to being moved to a 3 % isoflurane anesthetic gas mask. Absence of withdrawal reflexes was considered sufficient anesthesia for surgery.
The animal was fixated in a dorsal recumbence position and a v-cut through the skin and abdominal wall was made. The heart was exposed by opening the thoracic cage, cutting through the diaphragm. A 10 mL syringe with a 1.2 mm cannula coated with 1.8 mg/mL EDTA (Sigma Life Science; Switzerland), was inserted into the left ventricle (cardiac puncture). Blood samples of 2 ml were drawn from the exposed and control Sprague Dawley rats. In accordance with the procedure previously described, 500 µL of the blood was immediately placed on liquid nitrogen for NE and CORT concentration measurements performed [31].
Tissue harvesting
All Sprague Dawley rats were euthanized by dislocation of the neck under isoflurane anesthesia. The pituitary gland and adrenal glands were harvested, frozen on liquid nitrogen and later stored in a – 80 oC freezer.
Enrichment of splenic myeloid cells
The spleen was mechanically disrupted with scissors, and pieces of spleen tissue were passed multiple times through a 10 mL syringe and filtered through a 70 µM cell strainer in order to get a single cell suspension. Mononuclear cells were retrieved by density centrifugation. The suspension was diluted with PBS (GE Healthcare Lifesciences; USA), loaded on top of a 15 mL LymphoprepTM medium (STEMCELL technologies; Norway) and centrifugated (400 x g for 30 min at 4 oC). The layer of mononuclear cells was carefully aspirated, diluted in PBS supplemented with 2% FBS, washed by centrifugation (300 x g, 10 min, 4 oC) and resuspended in PBS (2% FBS). Myeloid cells were purified from the spleen mononuclear fraction by immunomagnetic bead separation. To avoid unspecific monoclonal antibody (mAb) binding, the Fc receptors were pre-blocked by incubating the cells in PBS with 10 % rat serum for 15 min at 4 oC. Subsequently, cells were incubated with a biotinylated mouse mAb (OX41) specific for rat CD172a (SIRP-α, expressed on the surface of all myeloid cells) at 2 µg/mL in PBS (10% rat serum) for 15 min at 4 oC and washed three times in PBS (2% FBS, 10 mM NaN3) before incubation with streptavidine-coated magnetic microbeads (MACS, Miltenyi Biotec; Germany) resuspended in PBS supplemented with 2 mM EDTA and 0.5% BSA for 30 min at 4 oC, using 40 µL of beads per 4 x 107 cells. The cells were then run through MACS LS columns in the magnetic field of a quadroMACSTM separator (Miltenyi Biotec; Germany) to separate bead-captured cells from unstained, non-myeloid cells according to manufacturer instructions.
Flow cytometry
Flow cytometry was used to verify the enrichment of CD172 positive cells and the nature of contaminating non-myeloid cells. Two separate mixes of fluorochrome-conjugated mAbs for test and isotype controls were used, diluted in PBS (2% FBS, 10 mM NaN3) (Supplementary Table 1). Staining with isotype control antibodies was included to evaluate unspecific mAb binding capacity to splenic cell subsets.
A small fraction of the cell sample i.e., 3 x 10 5, was used for flow cytometry analysis and incubated with 50 µL mAb test or isotype mix (2 µg/mL) in PBS (2% FBS, 10 mM NaN3) for 30 minutes on ice. After staining with primary antibody mixes, the cells were washed three times by centrifugation (300 x g, 2 min, 4 oC), resuspended in PBS (2% FBS, 10 mM NaN3) and incubated with Streptavidin-Alexa Fluor 647 conjugated for detection of OX41-biotin or IgG1-biotin binding, respectively. Cells were washed and analyzed on a CytoFlex flow cytometry (Beckman Coulter Life Sciences, USA) using CytExpert software.
RNA isolation and cDNA synthesis
The allprep DNA/RNA/miRNA Universal Kit (Qiagen; Germany) was used to isolate total RNA from the frozen pituitary, adrenal and enriched myeloid cells. Total RNA was extracted by homogenizing the frozen tissue with magnetic beads in a bead beater. The lysate was then used for RNA isolation following the manufacturer’s protocol. Synthesis of cDNA from these tissues was carried out using the qSCript cDNA synthesis kit (Quanta Biosciences Inc.; USA).
Gene expression analyses
RNA quantification of the different genes was achieved by a two-step real-time reverse transcription qPCR (RT-qPCR). Primer sequences (fwd,rev) were from Sigma Life Sciences, Switzerland: POMC (5’AACGCCATCAAGAAC3’ and 5’AAGGTTTTATTTCCTAACTACAC3’); NR3C1 (5’CAGAGAATGTCTCTACCCTG3’ and 5’CTTAGGAACTGAGGAGAGAAG3’); MC2R (5’AGAAACTGGATCCTTCCG3’ and 5’TGGTGTGTTCATACGAATTG3’); β-actin (5’CTAAGGCCAACCGTGAAAAGA3’ and 5’ACAACACAGCCTGGATGGCAT3’); IL-6 (5’TGCCCTTCAGGAACA3’ and 5’AAGGCAGTGGCTGTC3’); ADRB2 (5’AAAGAGAGAGAGAGAGACT3’ and 5’ACAACACTTCAGACAGAAAC3’); HPRT (5’ACTGGTAAAACAATGCAGGAC3’ and 5’CCTGAAGTGCTCATTATAGTC3’); PtPrc (5’GCTATAAAAAGACCCCTTCAG3’ and 5’CATAGGCAAATAGAGACACTG3’); ARRB2 (5’GCAGCCAGGACCAGAGGACA3’ and 5’CCACGCTTCTCTCGGTTGTC3’). PCR was run on Quantstudio 5 (Thermofisher Scientific; Norway) and analyzed using QuantstudioTM Design & Analysis Software.
Statistics
The data were shown by representative examples and mean ± standard error of the mean. Statistical analyses were conducted with Sigmaplot 14.0 and the level of significance was set to p<0.05. Shapiro-Wilk test was run to assess normality. Differences in body weight, social interaction, locomotion, gene expression levels and differences in percentage of myeloid cells between exposed group and control group were analyzed using Student’s t-test.