2.1. Chemical and reagents. Puromycin and ploybrene were purchased from Sigma-Aldrich Chemicals Co. (St Louis, Mo). The fluorescent dye JC-1 was provided by Invitrogen Thermo-Fisher (Shanghai, China). All cell culture reagents and qPCR reagents were obtained from Gibco BRL Co. (Grand Island, NY). The antibodies of the present study were provided by Santa Cruz Biotechnology (Santa Cruz, CA) and Cell Signaling Tech (Suzhou, China). The primers, sequences, constructs and virus were designed and provided by Shanghai Genechem Co. (Shanghai, China), unless otherwise motioned.
2.2. T-HESC cell culture. As described previously [4, 5], the immortalized human endometrial cell line, T-HESC [39], was cultured in regular DMEM/Hams F-12 nutrient medium plus 10% FBS.
2.3. Culture of primary human endometrial cells. The fresh human endometrial tissues, acquired from a written-informed consent uterine-bleeding patient (31-year old, administrated at Changzhou Second People's Hospital, undergoing the partial hysterectomy surgery) were digested with 0.15% trypsin-EDTA (Sigma) and Collagenase I (Sigma) for 1h, and then transferred to DMEM/Hams F-12 nutrient medium plus 15% FBS. Tissues were dissolved. Blood vessel cells, immune cells and other non-endometrial cells were abandoned through gravity sedimentation. The remaining human endometrial cells were resuspended and cultured in complete DMEM medium [5]. The primary human endometrial cells at passage 3-10 were utilized for biomedical assays. The protocols of using human tissues and cells were approved by the Ethics Committee at Changzhou Second People's Hospital.
2.4. miR-941 overexpression or inhibition. The pre-miR-941 nucleotide sequence and its anti-sense sequence were synthesized and sequence-verified by Shanghai Genechem Co. Each of the two was ligated to the GV248 construct (Shanghai Genechem Co.). The construct, along with the lentivirus-packing helper plasmids (psPAX2 and pMD2.G [33]), were co-transfected to HEK-293T cells, forming the pre-miR-941-expressing lentivirus (“lv-pre-miR-941”) and the pre-miR-941 anti-sense lentivirus (“antagomiR-941”). Virus were enriched, filtered, and added directly to human endometrial cells (in the polybrene-containing medium). When necessary puromycin (5.0 μg/mL) was included in the medium to select stable cells, with miR-941 levels examined by qPCR.
2.5. qPCR. The human endometrial cells, with the applied treatments, were harvest and the total cellular RNA extracted using TRIzol protocol [5]. We utilized an ABI Prism 7500 Fast Real-Time PCR system to carry out the quantitative real time-PCR (qPCR) assay. To calculate product melting temperature we applied the melt curve analyses. Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was always examined as the reference gene and the internal control, and the 2−∆∆Ct method utilized for the quantification of targeted mRNAs. The following mRNA primers were utilized: NQO1 (NM_000903) forward, 5’-CATTCTGAAAGGCTGGTTTG and reverse, 5’-GGCTGCTTGGAGCAAAATAC; HO1 (NM_002133) forward, 5’-GCTACCTGGGTGACCTGTCT and reverse, 5’-GGGCAGAATCTTGCACTTTG; Nrf2 (NM_006164) forward, 5’-TGAGCATGCTTCCCATGAT and reverse, 5’-CTTCTCTAGCCGCTCTGTGG; GAPDH (NM_002046) forward, 5’-CGGAGTCAACGGATTTGGTCGTAT and reverse, 5’-AGCCTTCTCCATGGTGGTGAAGAC. Keap1 (NM_203500) forward: 5’-TACGATGTGGAAACAGAGACGTGGA and reverse 5’-TCAACAGGTACAGTTCTGGTCAATCT. The primers cover exon junction/s, and the amplicons around 90-200 bp. miR-941 was normalized to U6. miR-941 and U6 primers were obtained from OriGene (Beijing, China).
2.6. Keap1 3'-UTR activity. Keap1 3'-UTR reporter plasmid (containing the miR-941-binding sites, at position of 276-283) was generated using the same protocol described previously [31], which was transfected to human endometrial cells using the Lipofectamine 2000 protocol. Afterwards, cells were subjected to the applied genetic modifications, with the Keap1 3'-UTR luciferase activity tested through the Promega kit [40].
2.7. Transfection of miR-941 mimic. Human endometrial cells were seeded into the six-well tissue culture plates (at 1 × 105 cells in each well). Lipofectamine 2000 was utilized for the transfection of 500 nM of the wild-type (“WT”) or the mutant (“Mut”) miR-941 mimics (synthesized by Shanghai Genechem Co.). After 48 h, miR-941 levels were determined by qPCR.
2.8. RNA-Pull down assay. The RNA-Pull down assay was carried out through the previously-described protocol [41, 42], testing miR-941-bound mRNA using the Pierce Magnetic RNA Pull-Down Kit, Shanghai, China). In brief, T-HESC cells were transfected with biotinylated miR-941 mimic or control mimic (100 nmol/L) for 48 h, and cells were harvested using the lysis buffer described early [42]. The biotin-captured RNA complex was pulled down by incubating the cell lysates (600 μg of each treatment) with the streptavidin-coated magnetic beads [41]. The bound mRNA was purified using the RNeasy Mini Kit (QIAGEN, Shanghai, China), with expression of Keap1 mRNA, in the bound fractions examined by qPCR. Its levels were normalized to the input controls.
2.9. Cell viability. Human endometrial cells were seeded into the 96-well tissue culture plates (3,000 cells in each well). Following the applied treatments, a cell counting kit-8 (CCK-8) kit (Dojindo Laboratories, Kumamoto, Japan) was utilized to examine cell viability [5], with CCK-8 optic density (OD) examined at test-wavelength of 450 nm.
2.10. Lactate dehydrogenase (LDH) assay. The human endometrial cells were seeded into the 12-well tissue culture plates (at 0.5 × 105 cells in each well). LDH release to the cell medium, the quantitative marker of cell necrosis [43], was tested through a two-step LDH detection kit (Promega, Shanghai, China) [5]. LDH contents in the medium were always normalized to total LDH levels.
2.11. OGD/re-oxygenation (OGDR). As described previously [4, 5], human endometrial cells with applied genetic treatments were initially placed into an airtight chamber (95% N2/5% CO2) for 4 h, mimicking OGD. Thereafter, human endometrial cells were returned back to the complete medium and re-oxygenated. Cells were further cultured for applied time periods.
2.12. Western blotting. Human endometrial cells were seeded into the six-well tissue culture plates (at 1 × 105 cells in each well). Following the applied treatments, cellular lysates were achieved and quantified [4, 5]. The lysates proteins (40 μg per treatment into each lane) were separated by SDS-PAGE gels, and transferring to polyvinylidene difluoride (PVDF) blots [44]. The detailed protocols for Western blotting and data quantification (through the Image J software) were previously described [45, 46]. Assaying of nuclear fraction proteins was described early [46].
2.13. Mitochondrial immunoprecipitation (Mito-IP). T-HESC cells were harvested and resuspended [5], with the supernatants collected as the cytosolic fraction lysates. The pellets were resuspended to achieve mitochondrial fraction lysates and quantified [47]. Mitochondrial fraction lysates (300 μg per treatment) were pre-cleared (using anti-IgG Sepharose beads), and incubated with anti-CypD antibody (Santa Cruz Biotech). The mitochondrial complex was captured by anti-IgG. CypD-p53-ANT1 association was examined by Western blotting assaying of CypD-bound proteins.
2.14. JC-1 mitochondrial depolarization assay. The human endometrial cells were seeded into the 12-well tissue culture plates (at 0.5 × 105 cells in each well). In OGDR-stimulated cells with mitochondrial depolarization (“∆Ψ”) the JC-1 fluorescent dye shall aggregate, forming green monomers [48]. The detailed protocol of JC-1 protocol was discussed previously [5]. The JC-1 fluorescence intensity was examined at 530 nm (Titertek Fluoroscan, Germany). The representative JC-1 images, integrating both green and red fluorescence images, were also presented.
2.15. Superoxide detection. Endometrial cells with the applied genetic treatments were initially seeded onto 96-well tissue-culturing plates (at 3 × 103 cells of each well). Following the applied OGDR stimulation, the superoxide colorimetric assay kit (BioVision, Shanghai, China) was applied to examine the cellular superoxide contents. In brief, the superoxide detection reagent (50 µL/well) was added for 15 min under the dark, with the superoxide’s absorbance tested at the test-wavelength of 450 nm [31].
2.16. Lipid peroxidation assay. As reported [31] endometrial cells with the applied genetic treatments were initially seeded onto the six-well tissue-culturing plates (at 1 × 105 cells per well). Following the applied OGDR stimulation, the lipid peroxidation assay kit (Abcam, Shanghai, China) was utilized to examine cellular lipid peroxidation levels, via the malondialdehyde method. The lipid peroxidation levels, determined by the thiobarbituric acid reactive concentration, were tested and quantified using the previously-described protocol [31, 49].
2.17. NQO1 activity. The detailed protocol for testing the relative NQO1 activity in human endometrial cells has been described elsewhere [50]. In brief, the inducer potency was quantified by using the NQO1 bioassay. T-HESC cells or the primary human endometrial cells (104 per well of a 96-well plate), with applied genetic treatments, were cultured for 24 h. The NQO1 enzyme activity was tested and quantified in cell lysates using menadione as the substrate.
2.18. Nrf2 or Keap1 knockout (KO). The lentiCRISPR-Nrf2-KO-puro construct and the lentiCRISPR-Keap1-KO-puro construct were described early [31], each was transduced to T-HESC cells (cultured in the polybrene-containing complete medium). Nrf2 sgRNA (Target DNA Sequence: TACACATTCAGCTGGCGCGT, PAM Sequence: AGG) and Keap1 sgRNA (Target DNA Sequence: GTACGCCTCCACTGAGTGCA, PAM Sequence: AGG) were utilized. The GFP-positive T-HESC cells were sorted via FACS. The selected single cells were further incubated in complete medium with puromycin for 10 days, with Nrf2/Keap1 KO verified by Western blotting and/or qPCR assays.
2.19. Keap1 re-expression. The Keap1 (with no 3’-UTR region) expression GV248 construct was designed and provided by Shanghai Genechem, transduced to T-HESC cells with miR-941 overexpression. Cells were then selected by puromycin for 10 days, with Keap1 re-expression verified by qPCR and Western blotting assays.
2.20. Statistical analysis. Data were presented as mean ± standard deviation (SD). The repeated-measures analysis of variance (RMANOVA) with Dunnett’s post hoc test for multiple comparisons (SPSS 16.0, SPSS Co. Chicago, CA) were utilized to evaluate statistical significance. The two-tailed unpaired T test (Excel 2013) was carried out to examine significance between two specific treatment groups. P < 0.05 was considered statistically significant.