Experimental Animals
A total of 33 male Sprague Dawley (SD) rats were obtained from Beijing Vital River Laboratory Animal Technology Co. Ltd. (Beijing, 100012, China. SCXK(Jing)2012–0001.) and maintained in suitable rooms with controlled conditions of temperature at 22±1℃, 40±10% relative humidity and light-dark cycles (12h- 12h, light onset at 7:00). Five rats were housed in one cage. During this experiment, standard food and drink water were available to the animals ad libitum. This study was approved by the institution ethical committee for animal care and use, Sanbo Brain Hospital, Capital Medical University. All efforts were made to minimize the number of animals used and their suffering. Experiments were performed during day, always at the same time, to avoid circadian variations. After finishing behavior tests, all animals were humanely euthanized using intraperitoneal injection of 3% sodium pentobarbital (50 mg/kg) and rapid decapitation. The process was as soon as possible to avoid interference on the results of experiment.
Experiment protocol
A random number generator was used to allocate the rats into different groups: control group (n = 10, C group, 577.00±47.53g) that received no surgery and anesthesia, splenectomy group (n = 10, S group, 577.60±33.73g) that was isolated cervical vagal nerve without stimulation, and splenectomy+VNS group (n = 13, SV group, 571.15±50.63g). Then all rats were conducted with Morris Water Maze (MWM) train (day 1–4) and test on day 7, Open Field Test (OFT) train on day 3 and test on day 7, splenectomy was carried on the day 4. Finishing behavior tests, all animals were decapitated for tissue preparation on day 7 (Figure 1).
Electric vagal nerve stimulation
Rats were fixed in a cage and anesthetized with 1% propofol (Fresenius Kabi AB. Rapsgatan 7, 751 74 Uppsala. Sweden. Serial number: 10MC2871.) 80mg/Kg intraperitoneally, after losing righting reflex, their tail vein was cathetered with 24-gauge catheter infusion set (Tuoren Medical Device Co., Ltd. Henan, 453401, China.) for continuous propofol infusion [12]. During the experiment, rats were allowed to breathe pure oxygen through a tube filled with oxygen continuously, which fixed in front of their nose in order to prevent hypoxia. After 10 min stabilization, heart rate was recorded as basic line. Thus, neck hair shaving and skin cleaning, aseptic technique was used to make a ventral midline incision in neck skin. Then skin and muscles were retracted. Because right vagal nerve primarily innervates atria and sinoatrial node, and these stimulation may induce significant change in cardiac rhythm. At the same time, right VNS produce smaller cardiorespiratory response, so right vagal nerve was applied [13, 14]. Isolating right cervical vagal nerve and common carotid artery bundle, a 1.5mm diameter silver bipolar cuff electrode was gently wrapped around the nerve bundle and fixed to the sternocleidomastoid muscle. Then the electrode was connected to stimulator (BL–820 Biological signal acquisition and processing system. Chengdu Techman Software Co. Ltd. Sichuan, Chengdu, 610100, China). The basic stimulation parameters were adapted to the threshold of individual animal and included 2V, 10Hz and 1ms, but these parameters were regulated constantly to preserve heart rate lower than 10% of basic line [14–17].
Splenectomy
After 30min of VNS, splenectomy began with a small lateral peritoneal incision. Using 3.0 silk thread to dissociate and ligate spleen artery and vein at hilum of spleen, spleen was removed at the root of far end of spleen pedicle. The completely removed spleen was examined to ensure that no residual spleen was left. Then the incision was closed, covering it with sterile activated-iodine gauze, and securing it with adhesive tape. The operation time was within 60min.
Behavioral tests
Open Field Test
OFT was applied in an apparatus, which was made of brown plywood, surface area was 50×50cm, surrounded by 50cm high walls. The floor was divided by black line into 25 rectangles. Rats were allowed to freely move in this apparatus for 5min. The movement of individual animal in the arena was automatically tracked by AVTAS ver5.0 animal video analysis system (AniLab Software & Istruments Co., Ltd. Ningbo, China.) The number of crossing and rearing activities by each rat during 5min was used to assess rats’ active explore behavior. After every test, the apparatus was cleaned with 5% ethanol.
Morris Water Maze
MWM was used to evaluate spatial reference learning and memory. A circle pool (150cm in diameter and 80cm deep) was filled with water and divided into four quadrants. An escape platform, which 40cm in height and 15cm in diameter, was submerged by 2cm under water surface and conserved to the center of northwest (NW) quadrant of this pool. Water was maintained at temperature of 23±2℃. The evaluation consisted of four training days of five consecutive trails per day, the last trail of each day was accepted. Rats were randomly introduced in this tank from different quadrants facing wall to find the escape platform in 60 sec. If the rats did not find the platform within 60s in the first trial, they were gently guided to the platform to remain for 30s. Then the rats were removed from the tank. This procedure ensured animals to retain visual-spatial information during trail. The movement of individual rat was automatically tracked by AVTAS ver5.0 animal video analysis system (AniLab Software & Istruments Co., Ltd. Ningbo, China.) On the last day of the test after operation, rats were assessed in this tank without the platform. The time to find the platform, the times of passing through the platform location, and the duration of time in the quarter of platform were counted.
Assessment of TNF-α, IL–6, IL–10 in serum
Levels of serum TNF-α, IL–6, IL–10 were measured by Enzyme-Linked Immunosorbent Assay (ELISA). Aliquots containing 100ul of serum were placed into wells of ELISA plates and the plate was incubated at 37℃ for 2h. Primary antibodies were rabbit monoclonal antibodies to TNF-α (Huamei, Wuhan. Number CSB-E11987r, 1:100 dilution), IL–6 (Huamei, Wuhan. Number CSB-E04640r, 1:100 dilution), IL–10 (Huamei, Wuhan. Number CSB-E04595r, 1:100 dilution). The primary antibodies were added to each wells and incubated at 37℃ for 1h. After three washes with PBS-Tween 20 (0.1%), a horseradish-peroxidase-conjugated goat anti-rabbit IgG was added into the wells and incubated for 1h at 37℃. The antibody-antigen complex was revealed by addition of 100ul of 2,2’-azinobis (3-ethylbenzthiazoline–6-sulfonic acid) (ABTS) containing 0.3% H2O2 into each well. After 15 min, optical density (OD) was determined using Bio Tek Epoch (Bio Tek Instruments, Inc. China. Beijing, 100025, China.) at 450 nm. All samples were processed under the same experimental conditions and time.
TNF-α protein in hippocampus
The proteins were extracted from hippocampus and their concentration was determined by Bicinchoninic Acid Kit (Catalog BCA02, Dingguo Changsheng Biology Technology LTD, Beijing, China). 30ug protein samples were separated by SDS-PAGE, followed by semi-dry transfer onto a PVDF membrane. The membrane was blocked in 5% non-fat dry milk. Further, membranes were incubated with rat monoclonal primary antibody, anti-TNF-α and anti-tubulin, for overnight at 4℃. This was followed by triple washing with 0.1% TBST and incubation with HRP labeled secondary antibodies for 2h at RT. Immunoreactive bands were detected by ECL and Western blot detection system using Quantity one (Bio-Rad Laboratories. Inc. Hercules, CA, USA). These steps were repeated triply in order to calculate mean value. Expressions of each interest protein were calculated after normalizing the interest protein with endogenous control tubulin in the same sample.
NF-κB in hippocampus expression
Total RNA was isolated from 100mg of hippocampal cortex using 1 ml of TRIzol (Invitrogen Corporation; Carlsbad, CA, USA) and then RNA was treated with RNase-free DNase I and quantified using Q5000 Spectrophotometer (Quawell Technology, Inc. San Jose, CA, USA). cDNA was obtained from 5ug of total RNA using 2ul of ReverTra Ace reverse transcriptase kit (Catalog TRT–101, TOYOBO STC (Shanghai) CO., LTD, Shanghai, China), 2ul of Oligo dT 50um, 2ul of dNTP mix 10mM, and water grade molecular biology to 20ul. Retrotranscription conditions were 30℃ for 10min, followed 42℃ for 60min and 99℃ for 5min, then 4℃ for 5min. Finally, the cDNA was stored at –20℃.
cDNA was used to amplify each gene using Sybr Green I (Catalog GG1301–50, Gen-View Scientific Inc. Florida, USA). The amplification reactions contained 1 ul of respective SybrGreen I, 12.5ul of Mix (Catalog PER012–1, Dingguo Changsheng Biology Technology LTD, Beijing, China), and 1ul of cDNA in a final volume of 25ul. The conditions were for qPCR were 3min for pre-denaturation at 95℃, followed by 35 cycles of amplification of 30s denaturation at 94℃, 30s annealing at 60℃ and 30s extending at 72℃. The last extending step was 10min at 72℃. Rat GAPDH was used as internal control gene for normalization. The amplification assays were made using ABI PRISM 7700 Sequence Detection System (ThermoFisher Scientific (China) LTD, Shanghai, China). Primer pairs for quantitative real-time PCR were as follows: NF-κB, 5’-AACCTGGGAATACTTCATGTGACTAA–3’ (sense) and 5’-GCACCAGAAGTCCAGGATTATAGC–3’ (anti-sense), GADPH, 5’- GCTGAGTATGTCGTGGACTC–3’ (sense) and 5’- TTGGTGGTGCAGGATGCATT–3’ (anti-sense). The steps were repeated triply in order to calculate mean value. The 2-ΔΔCt analyses were applied to calculate the relative transcript levels expressed as fold change for gene expression [18].
Statistical analysis
SPSS 16.0 for Windows software package (SPSS, Inc, Chicago, IL, USA.) was used to perform statistical analysis. Quantitative data were expressed as mean±standard deviation (x±s).. Normal distribution of data was check by Kolmogorov-Smirnov analysis. One-way ANOVA Post Hoc Multiple-Comparisons was used for multi-group comparisons of means. When homogeneity of variances occurred, L-S-D was used to compare between groups. When variances were heterogeneous, Dunnett T3 was used to compare between groups. Two-way repeated-measured ANOVA was use to analysis the data of escape latency. The mean difference was significant at 0.05 level.