2.1. Cell culture of HT-29 colon cells
HT-29 colon cell line provided by Sukran Yılmaz, Sap Institue, Ankara, Turkey. HT-29 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) and incubated at 37˚C in a humidified atmosphere of 95 air and 5% CO2 incubator. Then, cells were seeded into a flask of 25 cm2 and following 24 h, these cells were treated with double combinations of these cytokine (TGFβ, IL1α). TNFα cytokine was also included in combination protocol.
2.2. Cell cycle analysis of HT-29 colon cells by flow cytometry
The analysis of the cell cycle phase was performed as described previously [16]. Briefly, cells were washed in PBS and then stained with PI using a commercial kit (Beckman Coulter, USA). Cellular DNA content was measured and analyzed on a flow Cytometry System with CXP software (Beckman Coulter FC500 System, USA).
2.3. Annexin V staining apoptosis test
HT-29 colon cells were seeded into a 6-well plate. After 24 h incubation process, each one of 1000U/mL TGFβ, IL1α separately and 1000U/mL various combinations of IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ.were added to the cells. The follow-up protocols were carried out according to the manufacturer protocol of AnnexinV-FITC kit (Beckman Coulter, USA). Samples were analysed by a flow cytometer and analyzed with CXP software (Beckman Coulter FC500 System, USA).
2.4. Total RNA isolation and cDNA synthesis
Total RNA isolation from the HT-29 cells was done with RNeasy mini kit (Qiagen GmBH., Germany). Reverse transcription for cDNA synthesis was performed in 20 μl final reaction volume including 50 U MuLV reverse transcriptase (Applied Biosystems, Foster City, CA), 10X PCR buffer, 5 pmol specific antisense primer, 4 U RNase inhibitor (Roche), 4 mmol/L of each dNTPs, 6.25 mmol/L MgCl2, and 2 μl (1ug) RNA. The RT step was performed as described previously on a Corbett Research Thermocycler at 42°C for 30 minutes followed by 94°C for 5 minutes [16] .
2.5. hCA9 gene expression
hCA9 (target gene) and TATA binding protein (TBP-housekeeping gene) gene expressions were carried out by quantitative Real-time RT-PCR using the Rotorgene system (Qiagen, Germany) [16]. The primers provided by Primer Design (Primer Design, USA) company designed depending on published information about mRNA sequences in GenBank (sequence Accession Nos., hCA9: NM_001216). For 105 bp amplification product, sense primer was “AGCAGAGGTAGCCGAGACT” (position:1.395) and antisense primer was “ATGAGCAGGACAGGACAGTTA” (position:1.499). For TBP gene, sense primer sequence was “CTGTTTAACTTCGCTTCC” and antisense primer sequence was “CTCTTCTCAGCAACTTCC”. The reactions were performed with 5 µL cDNA template in a final volume of 25 µL, containing 12.5 μL Sybr Green master mix (Qiagen, Germany), with 15 pmoL primers for whole genes in a Rotor-Gene Real-time PCR instrument (Qiagen, Germany). Initial denaturation was 1 min at 94°C, 40 cycles of specific annealing temperature for 2 sec, extension at 72°C for 10 sec and denaturation at 94°C. Melting curve analysis was carried out in the temperature range of 55 to 95 °C. We calculated the relative quantification using the ratio between hCA9 and TBP mRNA. Arbitrary copy numbers were analyzed using Rotor-Gene v.5 software (Qiagen, Germany). A melt curve was obtained from 65-99oC for the specificity of the reaction. Three technical and biological reactions were performed for each transcript and negative control was used.
2.6. hCAIX protein expression
Brifly, after cell culture procedures, cells were scraped with cell scraper and then 1x105 cells suspended in PBS. Human anti-CAIX antibody was added in each test tube for 45 minutes in ice bath and then washed with PBS to remove unbound antibodies. The assay was carried out in triplicate. The expression of hCAIX was monitored and analyzed on a Beckman Coulter FC500 Flow Cytometry System with CXP software (Beckman Coulter, USA).
- Statistical analysis
Each data was the mean of three independent values. All data were expressed as mean ± S.D. and analyzed one-way ANOVA Test by SPSS 11.5 (SPSS Inc., Chicago, IL, USA) to determine the significance of differences between groups (untreated control cells and treated cells). P< 0.05 was considered statistically significant.