Animals
Nine-week-old Male Sprague Dawley rats were bred in the Experimental Animal Room of Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Xuzhou Medical University. All rats were housed under controlled room of humidity (50% ± 10%) and temperature (24 ± 1 °C) in a normal rhythms of everyday life (12 h day/night cycle) with free access to water and rodent chow. Animal experiments were approved by the Animal Ethics Committee of Xuzhou Medical University. All experiments were conformed to Guidelines for Ethical Conduct in the Care and Use of Animals, and the stress to the animals was minimized.
Design of the animal experiments
The rats (about 10 weeks of age) with absolute diet for 12 h more were intraperitoneally subjected to a single dose of streptozotocin (STZ, 60 mg/kg), freshly dissolved in 0.1 mol/L sodium citrate buffer at pH 4.5 [35]. Age-matched normal rats received an injection of sodium citrate buffer alone. Development of diabetes was confirmed by fasting blood glucose (FBG) level using a reagent kit of glucose detection (Jiancheng Bioengineering Institute, Nanjing, China). The rats with FBG levels higher than 13.9 mmol/L (250 mg/dL) were considered to be diabetic rats on day 5 after STZ injection [35]. Then, the diabetic rats were randomly divided into three groups with 10 animals each group, i.e., diabetic rats, diabetic rats treated with two doses of sarsasapogenin (Sar, 20 and 60 mg/kg, p.o.). Sarsasapogenin (purity > 98%, Beijing Medicass Biotechnologies, Co. Ltd., China) was suspended in 1% (w/v) sodium carboxymethylcellulose. Meanwhile, normal rats and normal rats with 60 mg/kg of Sar (both n = 10) were designed. Uncontrolled diabetic rats and age-matched normal rats both received sodium carboxymethylcellulose solution only.
After treatment for eight weeks, animals were performed for learning and memory tests in Morris water maze for five consecutive days. On the following day, the animals were sacrificed under isoflurane anesthesia, and the blood was collected by femoral vein bleeding. Then the whole brain was rapidly removed, and two sides of the hippocampus and the cerebral cortex were isolated, storing at -80 °C until the biochemical assays.
Morris water maze test
The Morris water maze tasks were employed for assessing the learning and memory ability according to our previous reports [4, 28]. A place navigation test was performed wherein the extent of learning was assessed for four consecutive days, and the escape latency (the time to reach the platform with seconds) was measured. A spatial probe test was performed wherein the extent of memory was assessed on day 5. Both the times of crossing the former platform and the percentage of time spent in the former platform quadrant were recorded.
Culture and treatments of SH-SY5Y cells
The SH-SY5Y cell line was purchased from Guangzhou Jennio Biotech Co., Ltd., China. The cells were cultured in Dulbecco's modified Eagle medium with Ham's F12 medium (DMEM/F12) containing 10% fetal bovine serum. DMEM/F12 culture medium and fetal bovine serum were purchased from Hyclone (Logan, UT, USA). After incubation for 24 h under normal conditions (medium containing 17.5 mmol/L glucose, 10% FBS, 100 U/mL penicillin and 100 μg/mL streptomycin, 5% CO2, 37 °C), and synchronization for 12 h, SH-SY5Y cells were divided into the following groups: normal glucose group (NG, 17.5 mmol/L glucose), high glucose group (HG, 70 mmol/L glucose), low, middle, and high concentrations of Sar group (HG+Sar,70 mmol/L glucose + 0.2, 1, 5 μmol/L Sar, respectively), and PAR-1 inhibitor group (HG+Vor, 70 mmol/L glucose + 0.1 μmol/L vorapaxar). Sar (SSP21002, purity > 98%, Beijing Medicass Biotechnologies, Co. Ltd., China) was dissolved in dimethylsulfoxide and made into stock solution (25 mmol/L) for use. Vorapaxar (Synonyms: SCH 530348, purity > 99.1%) purchased from Medchem Expression Company (HY-10119, St. New Jersey, USA) was diluted with dimethylsulfoxide and made into stock solution for use. After treatment with the above different agents for 48 h, the cells were harvested for indices analysis. The culture time was selected according to the changes of PAR-1 protein by immunofluorescence in SH-SY5Y cultured with 70 mmol/L glucose for 24, 48, and 72 h, respectively.
Assay of cell viability
Cell viability was used for cytotoxicity assessment with a CCK-8 kit (Dongren Chemical Technology Co., Ltd., Shanghai, China) as previous report [36]. Briefly, cell suspension (100 μl/well, 1.0×106/ml) was preincubated in a 96-well plate for 24-48 h at 37 °C in a humidified atmosphere of 5% CO2. After the cells were incubated in different groups for 48 h, 10 μl of the CCK-8 solution was added to each well of the plate and incubated for 2-4 h in incubator. After 10 μl of 1% (w/v) SDS was added to each well in dark at room temperature, the absorbance was determined at 450 nm using a microplate reader. The net absorbance of cells cultured with normal glucose was considered as 100% cell viability.
Assay of lactate dehydrogenase (LDH) release
On the day of LDH assay, the assay reagents (Beyotime Biotechnology, Nantong, China) were prepared according to the manufacturer’s protocol [37]. The cells at passage 11-13 were used to determine LDH release. One milliliter of cells at a density of 5×105 cells/mL (RPMI containing 10% FBS) were seeded in each well in a 96-well plate and grown for 48 h. The cells were washed with PBS three times and performed with different treatments. One hour before the scheduled detection time point, the cell culture plate was taken out from the incubator, and the reagent provided by the kit was added to the “control well with maximum enzyme activity”. After adding the reagents of LDH release, mix repeatedly by pipetting several times and continue to incubate in the incubator. After the predetermined time was reached, the culture plate was centrifuged for 5 min in a multi-well plate centrifuger at 400 g. The supernatant (120 μL) of each well was taken and added to the corresponding well in a new 96-well plate, 60 μL of test solution was added into each well, fully mixed, incubated at room temperature for 30 min in the dark, and then the absorbance was then measured at 490 nm. The measured absorbance of each group should be subtracted from the background blank control well absorbance, and cytotoxicity or mortality (%) = (sample absorbance - control absorbance) / (absorbance of cell maximum enzyme activity - control absorbance).
Assay of thrombin activity
Thrombin activity was assessed by a fluorometric assay based on the cleavage rate of the biosynthetic thrombin substrate Boc-Asp (OBzl)-Pro-Arg-AMC according to previous study [38]. Protein concentration in the supernatant of cell or tissue homogenates was determined by the BCA method. The buffer solution (pH = 8.8) contains Tris/HCL 1.21 g, CaCl2 22.2 mg, NaCl 1.755 g, and BSA 0.2 g in 200 mL deionized water. The 77 mg Boc-Asp (OBzl)-Pro-Arg-AMC fluorogenic substrate (Nanjing Peptide Industry Biotechnology Co., Ltd, China) was dissolved in 10 mL of dimethylsulfoxide, mixed well in dark, and stored at -20°C in avoiding light until use, and 1.0 mg bestatin (Selleckchem, China) in 1 mL dimethylsulfoxide for storage at -20°C until use. According to the total protein amount of 60 μg, the enzymatic sample was added to the reaction system with a final volume 100 μL including bestatin and the fluorescent substrate in a black 96-well microplate, and the control groups were designed. After fully mixed, the reaction was carried out in an oven at 37 °C for 50 min, then the optical density value was immediately measured with a fluorescence spectrophotometer at Ex/Em=360 nm/465 nm. The RFU values of all the groups were recorded.
IL-18 and IL-1β assay by ELISA
IL-18 and IL-1β levels were measured by using corresponding human IL-18 and IL-1β ELISA kits (Wuhan Boster Bio-technology Co., Ltd., China) according to the manufacturer's instructions.
Assay of AGEs levels
AGEs assay in tissues was performed according to our previous report [39]. Simply, the brain tissue was homogenized and centrifuged, and the residual pellets were collected and repeatedly washed with different reagents in order. The final pellets suspended in 1.0 mL of HEPES buffer containing 290 U of type I collagenase (Sigma-Aldrich Company, USA) and antiseptics were mixed and shaken for 24 h at 37 °C. After centrifugation, the supernatant was collected for the determination of fluorescence intensity at Ex/Em=370 nm/440 nm. AGEs levels in cerebral cortex were expressed as alteration of the enzyme activity of type I collagenase (U/ mg protein).
Western blot assay
Protein concentration of the sample was determined using a BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). The protein samples were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 2% milk powder solution for 60 min. Primary antibodies including anti-NLRP1 (Abcam Company, USA, 1:1000), anti-cleaved-caspase-1 (Bioworld Company, USA, 1:1000), anti-PAR-1 (Sigma-Aldrich Company, USA, 1:1000), anti-RAGE (Abcam Company, UK, 1:1000), anti-NF-κB p65 antibody (Affinity Biosciences, UAS, 1:1000), and anti-NF-κB p-p65 (Affinity Biosciences, UAS, 1:1000) were incubated overnight at 4°C, followed by IRDye purified goat anti rabbit IgG(H+L) secondary antibodies (Li-Cor Inc., Lincoln, NE), respectively. Immunoreactive blots were detected using Infrared Imaging System (Gene Company Limited, Hong Kong, China), and the signal densities on the blots were measured with Image J software; meanwhile, they were normalized using rabbit anti-β-actin antibody (Bioworld Technology, St. Louis, USA) or rabbit anti-GAPDH antibody (ABclonal Biotechnology Co., Ltd., USA) as an internal control.
Immunofluorescence assay
Immunofluorescence assay was performed according to the report [40]. Cells plated on coverslips were fixed in ice cold 4% paraformaldehyde for 15 min at -20°C, permeabilized with 0.1% TritonX-100 in PBS for 10 min, treated with blocking medium (1% bovine serum albumin in PBS) for 30 min, and then incubated overnight at 4°C with anti-PAR-1 antibody (Cat No.Cleaved-Ser42, Sigma-Aldrich Company, USA), anti-NF-κB p65 antibody, or anti-NF-κB p-p65 (Affinity Biosciences, UAS). Immune-reacted primary antibody was detected following for 1 h incubation in dark place at 37°C with a secondary antibody Dylight 594 Affinipure donkey anti-rabbit IgG (H+L) (Earthox, Millbrae, CA, USA). The cells were further stained with DAPI (Vector, Burlingame, CA, USA) for 2 min in dark place at room temperature and washed, and then were mounted onto microscope slides in mounting medium. Observations were carried out by using an Olympus BX43F fluorescence microscope (Tokyo, Japan).
Real-time qPCR assay
Total RNA was isolated from tissues or cells using TRIzol Reagent (Invitrogen, USA). According to the cDNA synthesis kit (#RR037 A, Takara, Japan), the mRNA was reverse-transcribed into single-stranded cDNA. The Roche 480 LightCycler® system with SYBR Green dye binding to PCR product was used to quantify target mRNA accumulation via fluorescence PCR using human or rat β-actin as a reference. The assay genes were rat PAR-1(forward 5′-GCCATCGCTGTGTTTGTCTT -3′, reverse 5′- CAGGAACCGGTCAATGCTTA -3′) and β-actin (forward 5′- CCCATCTATGAGGGTTACGC -3′, reverse 5′- TTAATGTCACGCACGATTTC -3′) as well as human PAR-1 (forward 5′- CGCAGAGCCCGGGACAATGG -3′, reverse 5′-CGGTGCGGGCAGACAACA -3′) and β-actin (forward 5′-TGACGTGGACATCCGCAAAG -3′, reverse 5′- CTGGAAGGTGGACAGCGAGG -3′). Lower Ct value indicated higher amounts of PCR products. For the amplification reaction in each well, a Ct was observed in the exponential phase of amplification, and the quantification of relative expression levels was achieved using standard curves for both target and endogenous control samples. Relative transcript abundance of a gene is expressed as 2-⊿⊿Ct values (⊿Ct = Cttarget﹣Ctreference).
Statistical analysis
All statistical analyses were carried out using GraphPad Prism 7.0 software. One-way ANOVA with Dunnet’s post hoc test was performed for analysis, or an unpaired, two-tailed Student’s t test for statistical analysis, wherever applicable. Data were represented as mean ± S.E.M. P < 0.05 was considered statistically significant.