Antibodies and reagents
Antibodies against to AMPKα (#5831), phospho-AMPKα (Thr172) (#2535), p38 MAPK (#8690), phospho-p38 MAPK (Thr180/Tyr182)(#9216), cleaved caspase-3 (#9661), Myc-tag (#2276), ubiquitin (#3936), β-tubulin (#2146) were from Cell Signaling Technology (Billerica, MA, USA). Antibodies against to AdipoR1 (ab70362), AdipoR2 (ab77612), and HSP60 (ab46798) were obtained from Abcam (Cambridge, MA, USA). Normal IgG (sc-2025) and secondary antibodies conjugated to horseradish peroxidase or alkaline phosphatase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) or Abbiotec (San Diego, CA, USA), respectively. Recombinant mouse adiponectin (ALX-522-059) and recombinant rat adiponectin globular form (Catalog#: SRP4593) were acquired from Enzo Life Sciences (Farmingdale, NY, USA) and Sigma-Aldrich (St. Louis, MO, USA), respectively. MG132 (HY-13259) was obtained from MedChemExpress (Monmouth Junction, NJ, USA).
Cell culture and treatment
Rat cardiac H9c2 cell (ATCC, CRL-1446) were cultured in DMEM containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Mouse liver HepIR cells (kind gifts from Drs, Feng Liu and Lily Q. Dong, UTHSCSA, USA) were cultured in MEM-alpha containing 10% FBS and 0.8 μM dexamethasone [6, 19]. All cells were maintained in a humidified incubator with 5% CO2 and 95% air at 37°C.
High glucose treatment was performed as our described previously [20, 21]. The control group received the treatment of 5.5 mM glucose and the identical concentration of mannitol which act as osmotic control to remove a hyperosmolar effect.
Plasmid construction
The cDNAs of full-length of mouse HSP60 , mouse AdipoR1, and mouse AdipoR2 were generated by PCR and subcloned into the mammalian expression vectors pcDNA3.1 (Myc-tagged), or pGEX, respectively, as described previously [6].
Small interfering RNAs and transfection
The small interfering RNAs (siRNAs) targeting rat HSP60 (NM_022229.2) and mouse HSP60 (NM_010477.4) were synthesized by Genechem Co., LTD (Shanghai, China). Transfection was performed with 120 pM of siRNA using Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies Corporation, Gaitherburg, MD, USA) according to the manufacturer’s protocol. The most effective sequences of siRNAs and its paired control used in the experiments were as follows: rat HSP60, 5′- GAGAGGTGTGATGTTGGCTGTTGAT-3′ and 5′- GAGTGTGGTAGGGTTTGTCTGAGAT -3′; mouse HSP60, 5’-CAAATGGAGACAAAGACATTGGGAA-3’ and 5’-CAAAGGCAGAAACAGTTAGGATGAA-3’. Knockdown efficiency was assessed by western blot.
Cell immunofluorescence
Immunofluorescence staining was performed as our described previously [6, 21]. Images were acquired on an Olympus IX83 laser scanning confocal microscope and analyzed by Olympus FV1200 software.
DHE staining
The real-time formation of ROS in cells was detected by dihydroergotamine (DHE) staining as described previously [21]. Briefly, the cells were plated on the coverslips within a 24-well plate at a density of 2×104 cells/well, starved serum for 6 hours, and then treated with or without high glucose and/or other compound for the desired time. DHE (at a final concentration of 10 mM) was used to stain the cells at 37°C for 30 minutes in the dark. Cells were then rinsed once with pre-warmed PBS. DHE fluorescence was captured with fluorescence microscopy and quantified by automated image analysis.
Apoptosis determination
Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) was performed to detect cells undergoing apoptosis as described by the manufacturer's protocol (Roche Applied Science, Indianapolis, IN, USA).
GST pull-down, immunoprecipitation and western blot
The pull-down assay, immunoprecipitation experiments, and western blot were performed as described previously [6].
Statistical analyses
The data are presented as the means ± SD. Differences between the groups were examined using one-way analysis of variance (ANOVA), followed by a Newman-Keuls post hoc test. The values of p<0.05 were considered statistically significant.