Identification of Lactobacillus species from chicken intestines
To identify potential probiotics, tissue from the small intestine of a chicken was extracted. After homogenizing the extracted tissue, MRS agar plates were used to selectively isolate gram-positive bacteria such as Lactobacillus, Bifidobacteria, and Enterococcus. Among the many colonies, the first screening process used microscopy to select rod-shaped bacteria. For further analysis, the 16S rRNA gene was used for bacterial identification. In the 16S rRNA sequencing analysis, most of the bacteria isolated from the small intestine were identified as Lactobacillus reuteri. Based on the result from EZcloud™ (chunlab, https://www.ezbiocloud.net), the 16S rRNA sequences were 99.60% similar to that of the L. reuteri JCM 1112 strain. Total 200 isolates including Lactobacillus intestinalis and Lactobacillus crispatus, from the intestine samples were isolated, but because most bacteria in the gastrointestinal tract were L. reuteri, we selected those isolates for further characterization.
Construction of a phylogenetic tree based on the 16S rRNA genes of L. reuteri strains
The phylogenetic relationships among the L. reuteri isolates and similar bacterial species were determined by comparing 16S rRNA sequences, which are known to be conserved in microorganisms. The reference sequences of the other Lactobacillus species (various L. reuteri strains (L. reuteri ZLR003, L. reuteri I5007, L. reuteri ATCC 53608, L. reuteri I49, L. reuteri JCM 1112, L. reuteri DSM 20016, L. reuteri IRT, L. reuteri TD1), L. fermentum IFO 3956, L. brevis ATCC 367, L. plantarum WCFS1, L. salivarius UCC 118, L. rhamnosus GG, L. paracasei ATCC 334, L. iners DSM 13335, L. johnsonii NCC 533, L. jensenii JV-V16, L. delbrueckii subsp. Bulgaricus ATCC 11842, L. crispatus ST1, L. helveticus CNRZ32, and L. acidophilus NCFM) were retrieved from the NCBI database (www.ncbi.nlm.nih.gov). Alignment of 16S rRNA sequences (average length, 1500 bp) was conducted using the CLUSTAL X program, and then we determined the phylogenetic relationships among bacterial species. To reconfirm the similarity identified in the EZcloud™ database, a phylogenetic tree was constructed using the Neighbor-Joining method with 10000 bootstrap replications, and we found that the L. reuteri chicken isolates belong to the same clade as similar L. reuteri strains (Fig. 1).
Characterization of a novel strain using high-throughput sequencing
Although 16S rRNA sequence analysis is widely used for routine identification of microorganisms, some researchers have suggested that additional experiments be conducted for further identification, even when a 16S rRNA sequence is 99% similar to an existing bacterial strain [10]. To determine whether the Lactobacillus strain isolated from a chicken was a new strain, we performed high-throughput sequencing using both the Illumina Hiseq 2000 (2 × 100 bp paired-end sequencing) and PacBio RS II platforms. Table 2 and Fig. 2 provide information about the genomic features and a circular map of L. reuteri SKKU-OGDONS-01 drawn by CIRCOS (http://circos.ca), respectively. The two-step assembly process was conducted using a total of 57,137,834 paired-end short reads generated from Illumina sequencing and 151,868 long reads generated by PacBio sequencing to make a complete genome. As the first step, draft genome assembly was conducted using the long reads, and the complete genome was finished using the short reads in the second step. The complete genome of L. reuteri SKKU-OGDONS-01 was 2,259,968 bp (N50 values 2,259,968) with a G + C content of 38.9%. Based on the PGAP result, the chromosome contained 2,165 genes, 1,941 putative coding sequences (CDS), 70 tRNA genes, and 18 rRNA genes. As shown in Table 3, we identified clusters of orthologous groups (COGs) in the genome of L. reuteri SKKU-OGDONS-01. The COG functional categories contain 2,165 genes, and the most abundant categories were J (translation, ribosomal structure, and biogenesis, 8.72%), X (mobilome: prophages, transposons, 8.68%), G (carbohydrate transport and metabolism, 5.66%), and E (amino acid transport and metabolism, 5.99%). Category S (function unknown, 6.57%) was also abundant.
Table 1
Specific primers used in this study
Gene | Forward (5’→3’) | Reverse (5’→3’) | Reference |
16S rRNA | GAGTTTGATCCTGGCTCAG | AGAAAGGAGGTGATCCAGCC | [50] |
GAPDH | TGGCAAAGTGGAGATTGTTGCC | AAGATGGTGATGGGCTTCCCG | NM_002046 |
IFN-β | TTACACTGCCTTTGCCATCCAA | TCCCACGTCAATCTTTCCTCTT | NM_010510.1 |
IFN-γ | ACTGGCAAAAGGATCGTGAC | GACCTGTGGGTTGTTGACCT | NM_008337.3 |
IL-6 | AGTTGCCTTCTTGGGACTGA | TCCACGATTTCCCAGAGAAC | NM_031168.1 |
TNF-α | CGTCAGCCGATTTGCTATCT | CGGACTCCGCAAAGTCTAAG | NM_013693.2 |
MNV capsid protein | CTCTCAGCCATGTACACCGG | TAGGGTGGTACAAGGGCAACAA | JQ237823.1 |
Table 2
General genome information for L. reuteri SKKU-OGDONS-01
| L. reuteri SKKU-OGDONS-01 |
Sequencing platforms | PacBio RS II / Illumina Hiseq2000 |
Assembler | PacBio SMRT Analysis 2.3.0 / Pilon (v1.21) |
Number of reads | 151,868 (PacBio) / 57,137,834 (Illumina) |
Genome coverage | 451 |
Genome size (bp) | 2,259,968 |
G + C content (%) | 38.9 |
Number of genes | 2,165 |
Predicted CDS | 1,941 |
Number of contigs | 1 |
Number of rRNA genes | 18 |
Number of tRNA genes | 70 |
N50 (bp) | 2,259,968 |
Table 3
Identified clusters of orthologous groups (COGs) in L. reuteri SKKU-OGDONS-01
COG | Description | Count | Ratio (%) |
J | Translation, ribosomal structure, and biogenesis | 182 | 8.72 |
A | RNA processing and modification | 0 | 0.00 |
K | Transcription | 111 | 5.32 |
L | Replication, recombination, and repair | 107 | 5.13 |
B | Chromatin structure and dynamics | 0 | 0.00 |
D | Cell cycle control and cell division | 35 | 1.68 |
Y | Nuclear structure | 0 | 0.00 |
V | Defense mechanisms | 51 | 2.44 |
T | Signal transduction mechanisms | 51 | 2.44 |
M | Cell wall/membrane/envelope biogenesis | 103 | 4.94 |
N | Cell motility | 5 | 0.24 |
Z | Cytoskeleton | 0 | 0.00 |
W | Extracellular structures | 0 | 0.00 |
U | Intracellular trafficking and secretion | 13 | 0.62 |
O | Posttranslational modification and chaperones | 59 | 2.83 |
X | Mobilome: prophages and transposons | 181 | 8.68 |
C | Energy production and conversion | 60 | 2.88 |
G | Carbohydrate transport and metabolism | 118 | 5.66 |
E | Amino acid transport and metabolism | 125 | 5.99 |
F | Nucleotide transport and metabolism | 77 | 3.69 |
H | Coenzyme transport and metabolism | 65 | 3.12 |
I | Lipid transport and metabolism | 51 | 2.44 |
P | Inorganic ion transport and metabolism | 63 | 3.02 |
Q | Secondary metabolite biosynthesis and transport | 22 | 1.05 |
R | General function prediction only | 119 | 5.70 |
S | Function unknown | 137 | 6.57 |
Multi | Multiple COG category | 169 | 8.10 |
Nohit | No hits against COG database | 182 | 8.72 |
Total | 2086 | 100 |
To determine whether the Lactobacillus isolated from the chicken was a novel strain, we conducted a comparative analysis based on the whole genome. The similarities among Lactobacillus strains were analyzed based on an OrthoANI algorithm, and a heatmap was generated to indicate similarities based on Average Nucleotide Identity (ANI) value (Fig. 3). As a result, L. reuteri SKKU-OGDONS-01 showed an average of 95% similarity to 9 different L. reuteri strains. Therefore, we registered the chicken-originated L. reuteri SKKU-OGDONS-01 in the NCBI genome database as a new strain. Information about this novel strain is accessible through accession number CP029615. Information about the sequencing reads (Sequence Read Archive number SRP162209) can be accessed through BioProject number PRJNA473291 and BioSample number SAMN09270376.
Survival rate of Lactobacillus strains in the gastrointestinal tract
We measured the survival rate and retention time in the small intestine, critical criteria of probiotics, to evaluate whether our potential probiotic strain can resist the strong pH of gastric and bile acids in the in vivo environment. To differentiate between commensal bacteria in the intestinal tract and the administered Lactobacillus, the probiotics were used in a transgenic form. To construct the transformed strains, we modified the pSLP111.3 vector by replacing the xylose-inducible promoter with an LDH (lactose dehydrogenase) constitutive promoter [9]. Then we used the chloramphenicol resistant gene to measure the survival rate and retention time of the administered Lactobacillus, as shown in Fig. 4. Antibiotics were treated prior to the administration of Lactobacillus so that the administered bacteria could easily settle into the intestine. The results showed no significant difference in survival or persistence compared with the L. paracasei ATCC 334 strain used as a control probiotic for either one or three administrations of Lactobacillus (Fig. 5a and 5b). However, we did find more colonies on the MRS plates after administration of L. reuteri SKKU-OGDONS-01 compared with administration of L. paracasei ATCC 334. When antibiotics were not given (to evaluate the congenital colonization activity of the chicken-originated strain), L. reuteri SKKU-OGDONS-01 did not survive for longer than the control Lactobacillus, just as we found with antibiotics (Fig. 5c and 5d). When L. reuteri SKKU-OGDONS-01 was administered three times every two days, colonies were observed at a relatively high level the day after administration (Fig. 5d). However, the chicken-derived Lactobacillus in mice had no noticeable advantage over the cheese-derived control in survival rate or retention time.
Safety aspects of L. reuteri SKKU-OGDONS-01
To assess the safety of L. reuteri SKKU-OGDONS-01, we administered a wild-type strain for 2 weeks instead of the transformed strain used in previous experiments, and then we measured and evaluated health state, weight change, food intake, and organ weights of the mice. All the mice were same weight at the start of the experiment, and the weight among the experimental groups did not differ during administration. Likewise, the total amount of food intake was essentially the same among groups (Fig. 6a and 6b). Even in the results of phenotypic changes and organ weights (liver, small intestine, and spleen) after completion of Lactobacillus administration, no differences among groups were observed, as shown in Table 4. Thus, the health of the mice was unaffected by administration of L. reuteri SKKU-OGDONS-01.
Table 4. Organ weights of mice fed Lactobacillus strains
Values are mean ± SEM for n=3
Bacteria
|
Liver (g)
|
Intestine (g)
|
Spleen (g)
|
Negative control
|
1.27 ± 0.01
|
0.67 ± 0.02
|
0.1 ± 0.01
|
L. paracasei ATCC 334
|
1.24 ± 0.04
|
0.62 ± 0.05
|
0.11 ± 0.02
|
L. reuteri SKKU-OGDONS-01
|
1.38 ± 0.11
|
0.73 ± 0.07
|
0.11 ± 0.01
|
Assessment of bacterial translocation
Before a Lactobacillus strain can be used as a probiotic, a thorough safety evaluation is needed, including a bacterial translocation test. We observed the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, looking for elevations that occur when the liver is damaged by bacterial translocation. Bacterial translocation was defined as even a single colony of Lactobacillus in the liver, kidney, or blood of the subjects and assayed among experimental groups as shown in Table 5. Except for one incidence, no obvious translocation events (migration of bacteria from gut tissues to other organs and blood) were detected. Elevated AST and ALT levels, as toxicity indicators of translocation, were analyzed. The normal ranges for AST and ALT in mice are 54–298 U/L, and 17–77 U/L, respectively [11]. We found that the ALT value in the mice that received L. reuteri SKKU-OGDONS-01 was 27 ± 2.94, and the AST value was 71 ± 9.2, as shown in Table 6. Considering ALT and AST levels of the negative control mice were 33.6 ± 3.68 and 79.6 ± 22.3, respectively, L. reuteri SKKU-OGDONS-01 caused no liver damage. Furthermore, the ALT/AST levels in mice fed L. paracasei ATCC 334 were also in the normal range (ALT: 32.3 ± 8.33, AST: 91.3 ± 11.44). Therefore, this potential probiotic could be used safely for further purposes.
Table 5
Incidence of bacterial translocation
Agar | Bacteria | Blood | Kidney | Liver |
MRS agar | Negative control | 0/3 | 0/3 | 0/3 |
L. paracasei ATCC 334 | 0/3 | 0/3 | 1/3 |
L. reuteri SKKU-OGDONS-01 | 0/3 | 0/3 | 0/3 |
BHI agar | Negative control | 0/3 | 0/3 | 0/3 |
L. paracasei ATCC 334 | 0/3 | 0/3 | 0/3 |
L. reuteri SKKU-OGDONS-01 | 0/3 | 0/3 | 0/3 |
The value indicates the number of animals with translocation / total mice. |
Table 6. Serum analysis of mice treated with Lactobacillus strains
Values are mean ± SEM for n=3
Group
|
ALT (U/L)
|
AST (U/L)
|
Negative control
|
33.6 ± 3.68
|
79.6 ± 22.3
|
L. paracasei ATCC 334
|
32.3 ± 8.33
|
91.3 ± 11.44
|
L. reuteri SKKU-OGDONS-01
|
27 ± 2.94
|
71 ± 9.2
|
Immune-boosting effect of L. reuteri SKKU-OGDONS-01
Intestinal microbiota play a key role in forming a biofilm in the intestine of the host, blocking various substances coming from the outside and contributing to homeostasis of the immune system, especially by interacting with immune cells in the intestine [12]. In particular, Lactobacillus are known to be good probiotics, with beneficial health effects demonstrated in many clinical trials and previously accumulated data. Depending on the mode of action, probiotics have various ways to enhance immunity in the host [13–15]. Even though L. reuteri SKKU-OGDONS-01 did not show a long duration in the small intestines of mice, we compared the expression of the representative cytokines known to be elevated by probiotics such as interferon(IFN)- β, IFN-γ, tumor necrosis factor-alpha (TNF-α), and interleukin-6 [13, 16] through administration of different Lactobacillus strains (L. paracasei ATCC 334, L. reuteri KACC 11452, and L. reuteri SKKU-OGDONS-01, respectively) for two weeks at a dose of 108 CFUs daily. The expression of cytokines was compared using quantitative real-time PCR. As shown in Fig. 7, the relative expression of IFN-β and IFN-γ, known antiviral cytokines, increased by 4 and 40 times, respectively, in mice fed L. reuteri SKKU-OGDONS-01 compared with mice without any treatment. We also confirmed that the expression of IFN-β and IFN-γ differed by 3 and 1.7 times, respectively, compared with mice treated with L. paracasei ATCC 334. The relative expression of TNF-α and interleukin-6 was 1.4 and 8.4 times higher, respectively, in mice fed L. reuteri SKKU-OGDONS-01 than in mice without any treatment. Our findings show that antiviral cytokines and IL-6, which act in opposing directions, increased at the same time, which differs from what was previously understood: a single Lactobacillus strain can induce expression of both pro- and anti-inflammatory cytokines.
Antiviral efficacy of L. reuteri SKKU-OGDONS-01 against murine norovirus
STAT-1 deficient (STAT1−/−) mice are highly susceptible to MNV-1 infection [17, 18], but in wild-type mice, the virus has a relatively low infectivity. Among wild-type mice, C57BL/6 mice were reported to be suitable for studying MNV, so this experiment was conducted using those mice [19]. The most important factor in controlling MNV infection is innate immunity, such as STAT-1, which is a primary mediator of both type I and type II interferon responses [20, 21]. It has also been reported that IFN-γ plays a particularly crucial role [22]. As shown in Fig. 8, the expression of IFN-β and IFN-γ in the intestines of mice treated with L. reuteri SKKU-OGDONS-01 increased significantly, so we expected that the mice would experience antiviral effects against MNV in the same conditions. To test that expectation, 3 wild-type Lactobacillus strains, including L. reuteri SKKU-OGDONS-01, were administered to mice daily for 2 weeks before MNV infection, and Lactobacillus administration continued after infection. Due to the unique characteristics of the MNV CR6 strain, the viral capsid protein was not found in the feces at the early stage of infection; however, the viral protein began to be detected 5 days after infection (Fig. 8). Because the virus can replicate in vivo for a long time, fecal samples were collected on days 5, 7, 9 and 14 post-infection for analysis. The antiviral effect of the Lactobacillus strains was most remarkable on day 7 after infection. Compared with the mice that received only the virus, the amount of viral protein in mice treated with L. reuteri SKKU-OGDONS-01 decreased by more than 35 times. In the comparison with the human-originated L. reuteri KACC 11452, we found that the amount of viral protein differed by 10 times on the 7th day after infection. As with the tendency in the results of the immune-boosting experiments, the induction of antiviral cytokines was highest in mice fed L. reuteri SKKU-OGDONS-01. Thus, our novel strain had the best antiviral efficacy among the Lactobacillus strains tested.
Screening for probiotic-related markers using in silico analysis
Although we fully investigated the safety of L. reuteri SKKU-OGDONS-01 using our in vivo system, we explored probiotic-related markers using an in silico system to further support our results. For the in silico data mining analysis, we used the Illumina Hiseq2000 platform to obtain transcriptome information for L. reuteri SKKU-OGDONS-01 cultured in a pH 7.0 environment which mimic its original niche. The transcriptome information obtained through high-throughput sequencing is shown in Table 7. Total reads (2,688,348,749 and 2,501,571,444 bp) were generated, and only the reads from which the adapter sequences were removed were mapped to chromosome sequences through BBMap. Several genes defined as probiotic markers in the literature [23, 24] were found, and we investigated their expression levels using FPKM values to determine how many of those genes were expressed by L. reuteri SKKU-OGDONS-01. When describing probiotics, the virulence factor is a combination of probiotic factor and adaptation factor, which are an essential part of microbe host by overcoming the strong pH of the stomach and the bile acid it encounters until it reaches the intestine [23]. Genes associated with the stress response and long-term acid adaptation, DnaK, DnaJ, GroES, GrpEL, GrpE, and the F0F1 ATP synthase subunits, were found in L. reuteri SKKU-OGDONS-01 (Fig. 9). When the expression levels of those genes were indicated in terms of FPKM, their average value was greater than 10,000. In addition, our data mining found sortase, dltD (D-adenylation of LTA), hemolysin III, and fibronectin-binding protein, which are all adhesion factors that allow the bacteria to adhere to the extracellular matrix of epithelial cells in the intestine [25]. The most well-known probiotic marker, exopolysaccharide, was also found, but it had a lower expression level than the other markers. Overall, several probiotic markers are highly expressed within L. reuteri SKKU-OGDONS-01, and these in silico data support our safety assessment of Lactobacillus in mice.
Table 7
Transcriptome data of L. reuteri SKKU-OGDONS-01
Index | LR-C-3 | LR-C-4 |
Total base reads (bp) | 2,688,348,749 | 2,501,571,444 |
Total reads (bp) | 26,682,928 | 24,812,502 |
No. of processed reads (bp) | 13,341,464 | 12,406,251 |
No. of mapped reads (%) | 9,599,295 (71.95%) | 10,977,992 (88.49%) |
No. of failed-to-align reads (%) | 783,882 (5.88%) | 720,124 (5.80%) |