Patient selection
In the present study, eighty women under the age of 35 and BMI 18-25 Kg /m2, who participated in an intracytoplasmic sperm injection (ICSI) program, were selected. The patients who were diagnosed by the Poseidon group1 subgroup 1b that included; [patients <35 years old with adequate ovarian reserve parameters (AFC>5; AMH>1.2 ng/ml) and with an unexpected poor or suboptimal ovarian response (subgroup 1b: 4-9 oocytes retrieved] (4). The patients were divided into two groups: without a healthy lifestyle (n=40, infertile women with poor response (POR) to ovarian stimulation history), and with a healthy lifestyle (n=40, infertile women with poor response (POR) to ovarian stimulation history). The healthy lifestyle group included women who did not use plastic containers for hot food, hot drink and foodstuffs store. However, the group without a healthy lifestyle included women who used excessive plastic containers to store hot food, hot drink and foodstuffs. Information on a healthy lifestyle was obtained using a validated food frequency questionnaire. The main exclusion criteria were women affected by endometriosis, and women with a history of uterus and ovaries operation. Furthermore, in this study, at the request of the patients, the treatment IVF/ICSIcycle was canceled, while they had a low number of follicles or lacked growth of follicles. The Ethics Committee at Royan Institute, Iran approved this prospective case-control study (No. IR.ACECR.ROYAN.REC.1394.150). All participants gave informed consent prior to inclusion in the study. We ensured the confidentiality of the patients’ identities by data anonymization during analysis. This research did not affect the treatment of patients.
Antagonist stimulation protocol
In this study, Controlled of ovarian stimulation (COS) was controlled from the third day of the cycle. The patients received regular, daily subcutaneous (SC) injections of recombinant follicle stimulating hormone (rFSH, Gonal-F, Serono, Switzerland). The first dose of rFSH for each patient was started according to sonographic monitoring, and AFC, estradiol (E2) level, and AMH for each patient were evaluated. In the stage of growing follicles >12 mm, the patients received SC injections of a GnRH antagonist, cetrorelix (Cetrotide®, Merck Serono, Germany). The protocol consisted of daily Cetrotide® SC injections until the criteria for human chorionic gonadotropin (hCG) administration were met. When more than 3 follicles reached diameters of at least 18 mm and E2 levels of 1000-4000 pg/mL When at least three follicles reached diameters of ≥18 mm as well as E2 levels of 1000-4000 pg/mL, each patient received an intramuscular (IM) injection of 10000 IU of hCG (Pregnyl®, Organon, Netherlands) or SC injection of 250 μgOvidrel (Merck Serono, Germany).
Isolation of cumulus cells
Following follicular puncture, the cumulus-oocyte complexes (COCs) were collected and washed at least 3-5 times in G-IVFTM medium (Vitrolife, Sweden) to remove blood and excess cells. Immediately after washing, the COCs were moved to a CO2 incubator at 37˚C for 2 hours in G-IVFTM medium. Cumulus cells were denuded from COCs by 80 IU of hyaluronidase, (Sigma, USA) [16]. After oocyte denudation, a pellet of cumulus cells was washed with phosphate-buffered saline (PBS), and RNA stabilizer reagent buffer was added for further analyses. Cumulus cells were immediately transferred toliquid nitrogenfor snap freeze, and then they were stored at -80˚C. The cumulus cells were denuded from metaphase II gametes (MII). In the IVF laboratory, MII gametes were fertilized by the ICSI process within 10 minutes after denudation, and they were incubated until the embryo transfer was processed. Fertilization was evaluated (16-20 hours after ICSI). According to our IVF laboratory standards process, embryos were graded by embryologist specialists at the pronuclear (16-20 hours) and cleavage stages (48-72 hours) [17]. Then, the embryologist selected 1 or 2 embryos for transfer. For successful embryo transfer, they considered the embryo grades, age of the patients, and previous ART cycles. The quality of the embryos at the cleavage stage was classified based on these criteria: [The excellent quality of embryo should be (≥4 cells or ≥8 cellsand <10 % fragmentation), the good quality of embryo should be (≥ 4 cells or ≥8 cells and 10-20% fragmentation), and the poor quality of embryo should be (<4 cells or <8 cells and >20 % fragmentation)] [18].
RNA extraction, cDNA synthesis and qPCR
Total RNA was extracted by a Trizol (TRI; Sigma-Aldrich, US) and treated with RNase-free DNaseI according to the manufacturer’s instructions. RNA concentration and purity were quantified using a Nanodrop2000 Spectrophotometer (Thermo, USA). Reverse transcription was performed at 25ºC for 10 min, 42ºC for 1h and then 70ºC for 10 min. For this reaction, cDNA was synthesized using the Revert AidTM H-Minus First Strand cDNA synthesis (Fermentas, German) by the random Hexa nucleotides primer (0.2µg/µl) in a solution (20µl) containing 4µl 5x reaction buffer, 1µl Ribonuclease inhibitor (20U/µl), 2µl dNTP mix (10mM) and RNase-DNase free water.
Real-Time PCR quantification
ICAM-1 and HLA-G were chosen as target genes, and 18srRNAwas utilized normalizae each sample. Primers were designed by the Primer Express 3.0 software for the real-time PCR. Table 1 presents the primer sequences. The real-time PCR was performed in a Step OnePlus™ instrument (Applied Biosystems, USA). The reaction contained 2µl cDNA, 10µl of Power SYBR Green master mix (TAKARA, Japan) and 1µl (of 5oo nM primer) of forward and reverse primers. The reactions were performed in duplicate. The thermal cycling condition for the amplification was 95°C for 10 min, followed by 40 cycles of 95°C for 15s and 60° for 10 min. The Ct data were determined using default threshold settings. The 2-ΔΔCT method was used to analyze the relative expression level of target genes (Livak&Schmittgen, 2001). Melt curve analysis was performed to determine the specificity of the real-time PCR assay. A t-test was used to investigate whether the differences between ICAM-1 and HLA-G genes expression were calculated by the 2-ΔΔCT method.
Table 1: Real time gene expression and MSP primers sequences
Primers for real time gene expression
|
sequences
|
Product size
|
|
F-ICAM-1
|
5′-GCAATGTGCAAGAAGATAGCCA-3′
|
105 bp
|
|
R-ICAM-1
|
5′-GGGCAAGACCTCAGGTCATGT-3′
|
|
|
F-HLA-G
|
5′-AGCTGTGGTGGTGCCTTC-3′
|
106 bp
|
|
R-HLA-G
|
5′-GGGCAGGGAAGACTGCTT-3′
|
|
|
Primers for MSP
|
sequences
|
Product size
|
CpG Island Info
|
F- ICAM1-M
|
CGCGATTTTTTTGGTTTTTC
|
169 bp
|
|
R- ICAM1-M
|
TATTTACTTAACCACCGCCTATACG
|
|
chr19:10,269,612-10,271,289
|
F- ICAM1-UM
|
GTTGTGTGATTTTTTTGGTTTTTT
|
171 bp
|
|
R- ICAM1-UM
|
TTTACTTAACCACCACCTATACATA
|
|
|
F- HLA G -M
|
CGTAGGTATATTGTTTATATTCGCG
|
185 bp
|
|
R- HLAG -M
|
TACCTAAAAAAACCCCAAAACG |
|
|
F- HLAG -UM
|
TGTAGGTATATTGTTTATATTTGTGG |
186 bp
|
chr6:29827777-29828817
|
R- HLAG -UM
|
CTACCTAAAAAAACCCCAAAACAC |
|
|
Protein expression level
Western blot analysis
The total protein was extracted from equal amounts of cumulus cells in all samples using lysis buffer (7M urea, 2Mthiourea, 4% CHAPS [w/v], 75 mM DTT, 1% ampholyte [w/v], and 40 mMTris‐HCl), and then the protein concentration was evaluated by bicinchoninic acid assay (Thermo Scientific, Rockford). Additionally, 40 μg of protein for each sample was used onto a discontinuous 12% SDS‐polyacrylamide gel and exposed to vertical electrophoresis. Afterward, the proteins were transferred to polyvinylidenedifluoride membranes (Bio‐Rad, Hercules). Subsequently, with 3% bovine serum albumin (Sigma‐Aldrich) as well as 1% of nonfat dry milk (Amersham, GE Healthcare Life Sciences, Little Chalfont, UK), the membranes blocked process was performed. The time required for membranes blocked process is 2 hours at RT. In this stage, the membranes were incubated for overnight at 4°C with primary antibodies against human ICAM1 (G-5) (1:1,000, Cat. No.: SC‐8439; SantaCruz, Madeira), HLA-G (4H84) (1:1,000, Cat.No.: sc-21799; SantaCruz, Madeira) and β‐actin (1:1,000, Cat. No.: A2228; Sigma‐Aldrich). In the next stage, the membranes secondary antibodies were used. Indeed, for 1.5 hours in RT, the membranes were exposed to horseradish peroxidase‐conjugated secondary antibodies. The identification of ICAM1 and β‐actin proteins was gained by goat antirabbit IgG (1:5,000, Cat. No.: ab6112; Abcam, Cambridge, UK), and antimouse IgG (1:10,000, Cat.No.: 7076; Cell Signaling Technology, Danvers) immunoglobulins, respectively (Fig. 1).Chemiluminescence detection system (Amersham) was used for protein visualization. The ImageJ software version 1.50i (US National Institutes of Health, Bethesda) was used to quantify protein bands intensity on the PVDF paper. The changes in ICAM-1 and HLA-G level were normalized against β‐actin as a housekeeping protein and then calculated regarding infertile women with a poor response to ovarian stimulation without a healthy lifestyle.
Methylation-specific polymerase chain reaction (MSP)
DNA isolation and bisulfite conversion
Genomic DNA was extracted from COCs by the QIAamp DNA Micro Kit (QIAGEN, Netherlands) according to the manufacturer’s instructions. DNA quantity and quality were measured using a Nanodrop 2000 Spectrophotometer (Thermo, USA). Genomic DNA was treated by bisulfite using the EZ DNA Methylation-Gold (Zymo research, Germany) according to the manufacturer’s instructions. After conversion, DNA was eluted in buffer (Qiagen) to a final concentration of 30 ng/μl.
Methylation-specific PCR (MSP)
The DNA methylation status of ICAM-1 and HLA-G genes in COCs samples was evaluated by the methylation-specific PCR (MSP). For MSP, we had to use specific primer pairs for both methylated and unmethylated promoter sequences. The primers were designed using the Meth primer and GeneRunner software. Each MSP reaction was performed in a total volume of 25 μL. One microliter of sodium bisulfite converted DNA was added into a 24 μL reaction mixture containing 0.5 U of hot start Gold Taq Polymerase ( Promega, USA), 5 μ L of the 10 × PCR buffer, 2.0 μ L of MgCl2 (50 mmol/L), 0.5 μ L of dNTP (10 mmol/L; Fermentas) and 1 μ L of the corresponding forward and reverse primers (10 μ mol/L dH2O up to final volume of 25 μ L). Sodium bisulfite treated DNA was amplified in two separate MSP reactions, one with a set of primers specific for methylated, and the one for unmethylated ICAM-1 and HLA-G promoters sequences (Table 1). For MSP positive control, we used fully methylated DNA (100%) and unmethylated DNA (0%), which the fully methylated DNA was made of MsssImethylase (NEB, Ipswich, MA, USA) using human placental genomic DNA (gDNA; Sigma Aldrich), and the unmethylated DNA was made of human placental genomic DNA (gDNA; Sigma Aldrich). To check the MSP method sensitivity, we used the fully methylated and unmethylated DNA with different serial dilutions: the ratio 1% to 99%, 5% to 95%, 10% to 90%, 20% to 80%, 35% to 65%, 60% to 40%, and 100% to 0% Methylated DNA was combined with unmethylated DNA, respectively. Thermo cycling conditions were as follows: 95 °C for 5 min followed by 40 cycles of 95 °C for 30 s, 63 °C for 60 s and 72 °C for 60 s, with a final extension of 72 °C for 4 min. MSP products for methylated and unmethylated ICAM-1 and HLA-G promoters were run on 2% agarose gels containing 40 mMTris-acetate/1.0 mM EDTA (pH = 8) and were visualized by ethidium bromide staining (Fig2). Methylation genes pattern visualization was performed using the enhanced chemiluminescence detection system (Amersham). The intensity of methylation genes bands on the agarose gel was quantified using the ImageJ software version 1.50i (US National Institutes of Health, Bethesda).
Data analysis
Relative gene expressions were calculated by the 2-ΔΔCt method. The normalized ΔCt value of each sample was calculated using reference genes. In this study, categorical variables were presented as number (%) and continuous variables as mean ± SD. The independent t-test was used to assess the mean differences in demographic and clinical characteristics between the groups. Chi-square analysis was used for qualitative data. Univariate and backward multiple linear regression, including all variables, were used to evaluate the association between ICAM-1 and HLA-G genes, proteins, methylation and some demographic and clinical variables. Statistical analyses were conducted using the IBM SPSS Statistics for Windows, Version 22.0 (IBM Crop., Armonk, NY, USA). All statistical tests were 2-tailed, and a P<0.05 was considered statistically significant.