Down-Regulated hsa-miR-190b-5p is Correlated With BCL11A Expression in Pediatric β-Thalassemia

doi:10.21203/rs.3.rs-1006073/v1

PDF

Research Article

Down-Regulated hsa-miR-190b-5p is Correlated With BCL11A Expression in Pediatric β-Thalassemia

https://doi.org/10.21203/rs.3.rs-1006073/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 17 Nov, 2021

You are reading this latest preprint version

Background: Transcription factor BCL11A is a key regulator of hemoglobin switching in adult β-thalassemia. Several microRNAs (miRNAs) involve in the pathology of β-thalassemia by regulations of BCL11A. However, the expressions and regulators of BCL11A in pediatric β-thalassemia were unclear.

Methods: 18 pediatric β- thalassemia patients and 11 healthy controls were selected in this study. We applied reverse transcript quantitative real time PCR (RT-PCR) to analyze the expression levels of hsa-miR-190b-5p and γ-globin in pediatric β-thalassemia patients and luciferase activity assay to find out the direct regulations of BCL11A . Correlation between hsa-miR-190b-5p and biochemical indicators, BCL11A was assessed by the Pearson’s correlation test.

Results: The expression levels of γ-globin in pediatric β-thalassemia patients were significantly increased. Moreover, the expression levels of hsa-miR-190b-5p were significantly down-regulated in pediatric β-thalassemia patients. Furthermore, hsa-miR-190b-5p was negatively correlated with BCL11A expression in pediatric β-thalassemia patients. Through luciferase activity assay, we found that hsa-miR-190b-5p was directly interacted with BCL11A 3’UTR 499-506 regions.

Conclusion: Our results suggested that hsa-miR-190b-5p played key roles in regulating of BCL11A expression, which might provide novel therapies in pediatric patients with β-thalassemia .

Epigenetics & Genomics

pediatric β-thalassemia

hsa-miR-190b-5p

BCL11A

β-thalassemia is an autosomal recessive hereditary anemia, characterized by the disruption of β-globin expression. β-thalassemia is highly prevalent in Mediterranean countries, including the Middle East, Central Asia, India and Southern China ^1,2. The phenotypes of β-thalassemia are variable ranging from severe anemia to clinically asymptomatic individuals because of the wide spectrum of mutations in a homozygous or compound heterozygous state ^3,4. Current treatments of β-thalassemia include regular transfusions and hematopoietic stem cell allogenic transplant. However, there are many challenges and limitations in the currently available conventional therapies^5-7. Epigenetic manipulations and genomic editing are novel therapeutic approaches ^8-11. An increased knowledge about the pathophysiology of β-thalassemia may lead to alternative treatments.

The decreasing of β-globin in β-thalassemia compensatory reactivates γ-globin expression and fetal hemoglobin (HbF) synthesis. Transcription factor B-cell lymphoma/leukemia 11A (BCL11A) is a key regulator of hemoglobin switching and HbF silencer in adult. BCL11A directly binds to the promoter regions of HbF and inhibits its expression ^12,13. Also, in β-thalassemia patients, the expression levels of BCL11A are decreased to reactivate HbF synthesis. Now, BCL11A represents an important therapeutic target of β-thalassemia ¹⁴. Some transcription factor, like Krueppel-like factor 1 (KLF1) regulate the development of β-thalassemia through the regulations of BCL11A. However, the expressions and regulators of BCL11A in pediatric β- thalassemia are unclear.

MicroRNAs (miRNAs) are a category of conserved, small non-coding RNA molecules (21–25 nucleotides in length) ^15,16. Studies show that miRNAs play potential regulatory roles in β-thalassemia by interaction with BCL11A ^17-19. For instance, increased expression of miR-30a was associated with decreased BCL11A expression and elevated γ-globin and HbF levels in adult β-thalassemia ¹⁷. Another study showed that the coding mRNA sequence of BCL11A can be targeted by miR-210 and miR-486-3p in adult β-thalassemia ^18,19. However, in pediatric β-thalassemia, miRNAs regulated the expression levels of BLC11A are unclear.

Previously, we analyzed the abnormal regulated miRNAs in pediatric β-thalassemia by miRNA sequencing and suggested that hsa-miR-190b-5p might participate in pediatric β-thalassemia by targeting on BCL11A ²⁰. In this study, we further analyzed the expression levels of hsa-miR-190b-5p in pediatric β-thalassemia patients by reverse transcript quantitative real time PCR (RT-PCR) and validated the direct regulations of BCL11A by hsa-miR-190b-5p in pediatric β- thalassemia.

Study participants

This study was approved by the Ethics Review Committee of Fujian Province Maternity and Child Health Hospital (approval no. 201, 2018). Written informed consent was obtained from all participants following a detailed description of the purpose of the study. 18 pediatric β- thalassemia patients and 11 healthy controls were selected in this study. All subjects had no genetic relationship. Blood cell parameters were analyzed on a Sysmex XN-3000 automatic hematology analyzer (Sysmex; Shanghai, China) and the hemoglobin components and levels were analyzed using an automated capillary electrophoresis system (CapillaryS 2, software version 6.2; Sebia, Paris, France). Biochemical indicators were determined by the chemiluminescent microparticle immunoassay (CMIA) (Abbott; ARCHITECT ci16200, USA). 5ml peripheral blood was collected from selected subjects, using PAXgene Blood RNA Kit and was used for further RNA isolation.

Molecular analysis for the thalassemia genotypes

Genomic DNA was extracted from the peripheral blood samples using a genomic DNA isolation kit (Qiagen) following the manufacturer's instructions. The three common deletional α-thalassemia (-- SEA /αα,-α 3.7 /αα, and -α 4.2 /αα) were detected using Gap-PCR with the thalassemia gene detection kit (Shenzhen Yishengtang Biological Products Co., Ltd)²¹. Point mutations in the three nondeletional α-thalassemia (α CS α/αα,α QS α/αα,α WS α/αα), and the 17 common β-thalassemia were detected using reverse dot blot hybridization (RDB) with the thalassemia gene detection kit(Shenzhen Yishengtang Biological Products Co., Ltd)²² following the manufacturer's instructions.

RNA extraction

Total RNA from peripheral blood was isolated using a miRNeasy Mini Kit (Qiagen) according to the manufacturer's protocol²⁰. The concentration and purity of the RNA samples was assessed as 260/280 nm and 260/230 nm ratios, respectively, and were measured by a Bio Photometer MULTISKAN GO (Thermo, America).

RT-PCR

cDNA for evaluation of hsa-miR-190b-5p and U6 was synthesized with a Mir-X^TM First Strand Synthesis kit according to the manufacturer’s instructions (Takara Bio, Inc., Japan) and cDNA for evaluation of mRNA (β-actin, γ-globin and BCL11A) synthesized with a PrimeScript™ RT-PCR kit according to the manufacturer’s instructions (Takara Bio, Inc., Japan).The following primers were used for qPCR: BCL11A sense: 5′- ACAGGAACACATAGCAGATAAAC -3′ and antisense: 5′- TATTCTGCACTCATCCCAGG -3′; β-actin sense: 5′- GCACAGAGCCTCGCCTT -3′ and antisense: 5′- GTTGTCGACGACGAGCG -3′; U6 sense: 5′- CTCGCTTCGGCAGCACA -3′ and antisense: 5′- AACGCTTCACGAATTTGCGT -3′; The hsa-miR-190b-5p primers was designed and purchased from Takara (Takara Bio, Inc., Japan). Quantitative real-time PCR (qRT-PCR) was performed using the StepOne Real-time PCR System (Applied Biosystems, USA). β-actin was the internal control in mRNA quantification and U6 was the internal control in miRNA quantification. Relative expression was calculated using the comparative cycle threshold method and the internal control genes. Three negative controls (no template cDNA) were also run with every experimental plate to assess specificity and to rule out contamination. The real-time PCR reactions were performed in three times for both target and internal control genes.

Cell Culture and Transfection

Human 293T cells was purchased from Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (DMEM; GibcoBRL, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (GibcoBRL, Gaithersburg, MD, USA). All cells were maintained at 37℃ in a humidified atmosphere containing 5% CO2.Hsa-miR-190b-5p mimics/inhibitors and the corresponding negative control were purchased from Ribobio (RiboBio Co. Ltd., Guangzhou, China). Cells were transfected at a concentration of 50 nM using Lipofectamine 6000 Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.

Plasmids and Luciferase Reporter Assay
Wild type or mutant human BCL11A 3`UTR fragments were synthesized by Sangon Biotech (Shanghai, China), respectively. Mutant human BCL11A 3`UTR fragments included BCL11A 3`UTR 499-506ACATATCA>TGTATAGT and BCL11A 3`UTR 2553-25599 (ACATATC>TGTATAG) were divined by using miRDB. These fragments were inserted into the multiple cloning sites of pmiR-RB-REPORT™. For the luciferase reporter assay, 293T cells were co-transfected with the reporter vectors and miRNA mimics (hsa-miR-190b-5p mimic or negative control (NC) mimic). After 48h, cells were collected and measured by using Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the kit instructions.

Statistical analysis

The normality of the sample distributions was calculated by the Kolmogorov-Smirnoff test. Because the samples had normal distribution, we used the t-test and one-way ANOVA to assess the data differences between the pediatric β- thalassemia patients and normal children and the data from different groups detected by Luciferase Reporter Assay. Correlation between hsa-miR-190b-5p and biochemical indicators, BCL11A was assessed by the Pearson’s correlation test. SPSS version 20.0 was used for statistical analysis. p values less than 0.05 were considered statistically significant.

1. The characteristics in pediatric β-thalassemia patients

Totally, 18 pediatric β-thalassemia patients and 11 healthy controls were studied. The genotypes of 18 pediatric β-thalassemia patients were shown in Table 1. All the 18 pediatric β-thalassemia patients were with genetic mutations of β-globin. The mutations of β-globin gene were concentrated in β^CD41-42 and β^IVS-2-654regions.

The hematological parameters of 11 normal children and 18 pediatric β-thalassemia patients were presented in Table 2. The mean age of the normal children (5.7±1.8 years) was not significantly different from the pediatric β-thalassemia patients (6.2±3.3 years). Compared with normal children, the mean level of red blood cells (RBC), hemoglobin, mean corpuscular hemoglobin (MCH) and hemoglobin A (HbA) was significantly lower in the β-thalassemia patients. On the contrary, the mean level of HbF in pediatric β-thalassemia (15.2±18.2%) was significantly higher than normal children (0.4±0.7%) (p < 0.05).

Table 1 The genotypes of pediatric β- thalassemia patients

Case no.	Age (years)	Sex	Genotype
1	5	Female	β^IVS-2-654(C^→^T)/β^{CD41-42(-TCTT)}
2	6	Female	β^{CD41-42(-TCTT)} /β^CD17(A^→^T)
3	5	Male	β^CD17(A^→^T) /β^CD71-72(+A)
4	7	Male	β^IVS-2-654(C^→^T) /β^−28(A^→^G)
5	12	Female	β^IVS-2-654(C^→^T) /?
6	1	Female	β^IVS-2-654(C^→^T) /β^CD17(A^→^T)
7	1	Male	β^IVS-2-654(C^→^T)/β^{CD41-42(-TCTT)}
8	9	Male	β^{CD41-42(-TCTT)} /β^{CD41-42(-TCTT)}
9	5	Male	β^{CD41-42(-TCTT)} /β^CD17(A^→^T)
10	8	Female	β^IVS-2-654(C^→^T) /β^CD17(A^→^T)
11	10	Female	β^{CD41-42(-TCTT)} /β^CD17(A^→^T)
12	9	Male	β^−28(A^→^G) /β^−28(A^→^G)
13	3	Male	β^CD17(A^→^T) /β^CD17(A^→^T)
14	11	Male	β^{CD41-42(-TCTT)} /β^CD17(A^→^T)
15	7	Female	β^CD17(A^→^T) /β^−28(A^→^G)
16	4	Female	β^IVS-2-654(C^→^T)/β^{CD41-42(-TCTT)}
17	2	Male	β^{CD41-42(-TCTT)} /β^−28(A^→^G)
18	7	Male	β^{CD41-42(-TCTT)} /β^{CD41-42(-TCTT)}

Table 2 The clinical characteristics of normal children and pediatric β- thalassemia patients

Hematological parameter	Normal(n=11)	pediatric β-thalassemia(n=18)
Sex (male/female) Age (years)	9/2 5.7±1.8	10/8 6.2±3.3
RBC(×10¹² /L)	4.7±0.4	2.5±0.5^*
HB (g/L)	131.7±6.0	60.6±12.3^*
MCV (fL)	82.2±3.2	79.1±8.0
MCH (pg)	28.2±1.3	25.3±2.6^*
HbA (%)	96.1±1.2	81.0±18.1^*
HbA₂ (%)	2.8±0.2	3.0±0.6
HbF (%)	0.4±0.7	15.2±18.2^*

RBC: Red blood cells, Hb: hemoglobin,, MCV mean corpuscular volume, MCH mean corpuscular hemoglobin, HbA: hemoglobin A, HbA₂：hemoglobin A₂,HbF: fetal hemoglobin. Data expressed as mean ± SD. The significant data were shown in values with *p < 0.05 using independent Student’s t test when compared to normal children

2. Down-regulated hsa-hsa-miR-190b-5p in pediatric β- thalassemia patients

Previously, we analyzed the abnormal regulated hsa-miR-190b-5p in pediatric β-thalassemia by miRNA sequencing in 5 pediatric β-thalassemia patients [34]. Expression levels of hsa-miR-190b-5p in 18 β-thalassemia patients were further studied. Compared with the normal children, hsa-miR-190b-5p was significantly down-regulated in pediatric β-thalassemia patients (p < 0.001) (Fig. 1). Moreover, the expression level of γ-globin in 18 pediatric β-thalassemia patients was significantly increased (p < 0.001), compared with normal children (Fig. 1).

3. Correlation between hsa-miR-190b-5p and biochemical indicators in pediatric β- thalassemia patients

To further analyze the roles of hsa-miR-190b-5p in the development of β-thalassemia, correlations between hsa-miR-190b-5p and biochemical indicators in pediatric β- thalassemia patients were determined. Our data showed that the expression level of hsa-miR-190b-5p was significantly negative correlated with the serum alkaline phosphatase (ALP) (r=-0.968, p=0.007) in pediatric β-thalassemia patients (Table3). However, total bilirubin (TBIL), direct bilirubin (DBIL), urea, creatinine and glomerular filtration rate (GFR) had no significant correlations with hsa-miR-190b-5p expression in pediatric β-thalassemia patients (Table3).

Table 3 Correlation between hsa-miR-190b-5p and biochemical indicator in pediatric β- thalassemia patients

		TBIL	DBIL	ALP	Urea	Creatinine	GFR
hsa-miR-190b-5p	Coefficient	-0.420	-0.801	-0.968	-0.984	-0.590	0.506
hsa-miR-190b-5p	P value	0.482	0.104	0.007^**	0.114	0.410	0.663

TBIL: total bilirubin, DBIL: direct bilirubin, ALP: alkaline phosphatase, GFR: glomerular filtration rate. *p<0.05

4.Correlation between hsa-miR-190b-5p and BCL11A in pediatric β- thalassemia patients

BCL11A is a key regulator of the reactivation of γ-globin in β-thalassemia. To study the correlations between hsa-miR-190b-5p and BCL11A, we further detected the BCL11A mRNA expressions in 18 pediatric β-thalassemia patients. We found that the expression of hsa-miR-190b-5p had a negative correlation with BCL11A expression in pediatric β-thalassemia patients (r=-0.522, p=0.026) (Fig. 2A). However, in normal children, the expression of hsa-miR-190b-5p had no correlation with BCL11A expression (r=0.053, p=0.877) (Fig. 2B).

5. hsa-miR-190b-5p interacts with the 3′UTR of BCL11A

Using luciferase assay, we determined the direct binding of hsa-miR-190b-5p in the 3′UTR regions of BCL11A. Schematic representation of the dual-luciferase reporter was shown in Fig3A. BCL11A 3'UTR region harbored two hsa-miR-190b-5p putative binding sites, BCL11A 3'UTR 499-506 and BCL11A 3'UTR 2553-2559 regions (Fig3B). Dual-luciferase plasmid with BCL11A 3'UTR or mutated BCL11A 3'UTR and hsa-miR-190b-5p were co-transfected into human 293T cells. Compared with the non-targeting oligonucleotide negative control, hsa-miR-190b-5p transfection significantly inhibited the luciferase activity, suggested the suppression of BCL11A by hsa-miR-190b-5p (Fig3C). Moreover, when the BCL11A 3'UTR 499-506 regions were mutated (Mut1), the luciferase activity was significant increased, compared with wild type BCL11A 3'UTR (p<0.01) (Fig3C). However, when the BCL11A 3'UTR 2553-2559 regions were mutated (mut2), the luciferase activity was not significant different with wild type BCL11A 3'UTR (p<0.01) (Fig3C). Those results suggested that hsa-miR-190b-5p was bound to the BCL11A 3′UTR 499-506 regions.

Hsa-miR-190b is abnormally expressed in multiple types of cancer, for instance, in breast cancer, endometrial cancer, lung cancer, gastric cancer, bladder carcinoma and colorectal cancer ^23-28 and involves in promoting tumor growth ^29,30, inhibiting tumor growth ^31,32, differentiation³³, autophagy ^34,35 and tumor prognosis ³⁶. Furthermore, hsa-miR-190b is up-regulated in obese adolescents with insulin resistance and participates in down-regulation of HLA-DRA expression ³⁷. However, there has been limited study of the roles of hsa-miR-190b in pediatric β- thalassemia

In this study, we collected 18 pediatric β-thalassemia patients and 11 normal children. Expression level of γ-globin in pediatric β-thalassemia patients was significantly increased in β-thalassemia patients. Consistent with our previous study, expression level of hsa-miR-190b-5p was significantly down-regulated in pediatric β- thalassemia patients, compared with normal children²⁰. Moreover, hsa-miR-190b-5p was significant negative correlation with serum ALP levels in pediatric β-thalassemia patients. Our data suggested that hsa-miR-190b may be involved in the pathology of pediatric β- thalassemia.

BCL11A is a key therapeutic target of β-thalassemia ¹⁴. We found that hsa-miR-190b-5p was negatively correlated with BCL11A mRNA expression in pediatric β-thalassemia patients. Furthermore, hsa-miR-190b-5p was bound to the BCL11A 3′UTR 499-506 regions. Our results revealed a new regulator of BCL11A in pediatric β- thalassemia. In conclusion, we showed the down-regulated hsa-hsa-miR-190b-5p was correlated with BCL11A expression in pediatric β-thalassemia. Further studies about the regulation of hsa-miR-190b-5p may lead to novel therapies in pediatric patients with β-thalassemia. Moreover, additional analyses are needed to assess the detailed mechanism of hsa-miR-190b-5p in the regulation of hemoglobin switch during pediatric β-thalassemia development.

Acknowledgments

We thank all patients for their cooperation.

Authors’ contributions

Meihuan Chen, Xinrui Wang and Haiwei Wang collected the blood samples performed the data analysis and wrote the manuscript. Liangpu Xu, Hailong Huang designed the study and supervised the work. Min Zhang ,Lingji Chen, Hong Chen,Yali Pan and Yanhong Zhang helped with the collection of blood samples.

Funding

This work was funded by the National Natural Science Foundation of China (no.81970170) and the Natural Science Foundation of Fujian Province (no.2019J01510)

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Written informed consent to participate was obtained from all of the parents of the participants in the study and the study was conducted in accordance with the Declaration of Helsinki. This study was proved by the Ethics Review Committee of Fujian Maternity and Child Health Hospital (2018-201).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflicts of interest.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

1. Weatherall DJ, Williams TN, Allen SJ, O’Donnell A. The population genetics and dynamics of the thalassemias. Hematol Oncol Clin North Am 2010;24: 1021–1031.

2.Lai Ketong,Huang Guifeng,Su Li et al. The prevalence of thalassemia in mainland China: evidence from epidemiological surveys.[J] .Sci Rep, 2017, 7: 920.

3. Origa Raffaella,β-Thalassemia.[J] .Genet Med, 2017, 19: 609-619.

4. Galanello Renzo,Origa Raffaella,Beta-thalassemia.[J] .Orphanet J Rare Dis, 2010, 5: 11.

5.Borgna-Pignatti C, Rugolotto S, De Stefano P, Zhao H, Cappellini MD, Del Vecchio GC, et al. Survival and complications in patients with thalassemia major treated with transfusion and deferoxamine. Haematologica. 2004;89(10):1187–93.

6.Modell B, Khan M, Darlison M. Survival in beta-thalassaemia major in the UK: data from the UK Thalassaemia Register. Lancet. 2000;355(9220):2051–2

7.Motta Irene,Bou-Fakhredin Rayan,Taher Ali T et al. Beta Thalassemia: New Therapeutic Options Beyond Transfusion and Iron Chelation.[J] .Drugs, 2020, 80: 1053-1063.

8.Brusson Mégane,Miccio Annarita,Genome editing approaches to β-hemoglobinopathies.[J] .Prog Mol Biol Transl Sci, 2021, 182: 153-183.

9.Mehta Jayesh,CRISPR-Cas9 Gene Editing for Sickle Cell Disease and β-Thalassemia.[J] .N Engl J Med, 2021, 384: e91.

10.Bao Xiuqin,Zhang Xinhua,Wang Liren et al. Epigenetic inactivation of ERF reactivates γ-globin expression in β-thalassemia.[J] .Am J Hum Genet, 2021, 108: 709-721.

11.Gong Yi,Zhang Xinhua,Zhang Qianqian et al. A natural DNMT1 mutation elevates the fetal hemoglobin level via epigenetic derepression of the γ-globin gene in β-thalassemia.[J] .Blood, 2021, 137: 1652-1657.

12. Liu Nan,Hargreaves Victoria V,Zhu Qian et al. Direct Promoter Repression by BCL11A Controls the Fetal to Adult Hemoglobin Switch.[J] .Cell, 2018, 173: 430-442.e17.

13. Martyn Gabriella E,Wienert Beeke,Yang Lu et al. Natural regulatory mutations elevate the fetal globin gene via disruption of BCL11A or ZBTB7A binding.[J] .Nat Genet, 2018, 50: 498-503.

14. Zeng Jing,Wu Yuxuan,Ren Chunyan et al. Therapeutic base editing of human hematopoietic stem cells.[J] .Nat Med, 2020, 26: 535-541.

15. Bartel David P,MicroRNAs: target recognition and regulatory functions.[J] .Cell, 2009, 136: 215-33.

16. Lim Lee P,Lau Nelson C,Garrett-Engele Philip et al. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs.[J] .Nature, 2005, 433: 769-73.

17.Gholampour, MA;Asadi, M ; Naderi, M,et al. miR-30a regulates γ-globin expression in erythoid precursors of intermedia thalassemia through targeting BCL11A. [J] . Mol Biol Rep.2020 May ;47(5) :3909-3918.

18. Gasparello Jessica,Fabbri Enrica,Bianchi Nicoletta et al. BCL11A mRNA Targeting by miR-210: A Possible Network Regulating γ-Globin Gene Expression.[J] .Int J Mol Sci, 2017, 18: undefined.

19. Lulli Valentina,Romania Paolo,Morsilli Ornella et al. MicroRNA-486-3p regulates γ-globin expression in human erythroid cells by directly modulating BCL11A.[J] .PLoS One, 2013, 8: e60436.

20. Wang Haiwei,Chen Meihuan,Xu Shiyi et al. Abnormal regulation of microRNAs and related genes in pediatric β-thalassemia.[J] .J Clin Lab Anal, 2021, undefined: e23945.

21. Zhou YQ,Xiao GF,Li LY, et al. Evaluation of clinical application of gap-PCR as a routine method for alpha-thalassemia carrier detection. Di. Yi. Jun. Yi. Da. Xue. Xue. Bao. 2002,22(5): 434–436.

22.Li D,Liao C,Li J, et al. Prenatal diagnosis of beta-thalassemia by reverse dot-blot hybridization in southern China. Hemoglobin.2006, 30(3): 365–370

23. Dai Wenzhu,He Jixiang,Zheng Ling et al. miR-148b-3p, hsa-miR-190b, and miR-429 Regulate Cell Progression and Act as Potential Biomarkers for Breast Cancer.[J] .J Breast Cancer, 2019, 22: 219-236.

24. Wu Yu-Shen,Lin Huapeng,Chen Duke et al. A four-miRNA signature as a novel biomarker for predicting survival in endometrial cancer.[J] .Gene, 2019, 697: 86-93.

25. Lu Shaohua,Kong Hui,Hou Yingyong et al. Two plasma microRNA panels for diagnosis and subtype discrimination of lung cancer.[J] .Lung Cancer, 2018, 123: 44-5

26. Wang Changzheng,Qiao Chuanhu,MicroRNA-190b confers radio-sensitivity through negative regulation of Bcl-2 in gastric cancer cells.[J] .Biotechnol Lett, 2017, 39: 485-490.

27. Chen Zhaohui,Yang Likun,Chen Liang et al. hsa-miR-190b promotes tumor growth and metastasis via suppressing NLRC3 in bladder carcinoma.[J] .FASEB J, 2020, 34: 4072-4084.

28. Zhao Qiang,Liu Chengkui,Cui Qing et al. hsa-miR-190b promotes colorectal cancer progression through targeting forkhead box protein P2.[J] .Exp Ther Med, 2020, 19: 79-84.

29. Chen Zhaohui,Yang Likun,Chen Liang et al. hsa-miR-190b promotes tumor growth and metastasis via suppressing NLRC3 in bladder carcinoma.[J] .FASEB J, 2020, 34: 4072-4084.

30. Zhao Qiang,Liu Chengkui,Cui Qing et al. hsa-miR-190b promotes colorectal cancer progression through targeting forkhead box protein P2.[J] .Exp Ther Med, 2020, 19: 79-84.

31. Hong Hui,Yao Shun,Zhang Yuanyuan et al. In vivo miRNA knockout screening identifies hsa-miR-190b as a novel tumor suppressor.[J] .PLoS Genet, 2020, 16: e1009168.

32. Zhao Luqing,Zhou Yangying,Zhao Yuelong et al. Long non-coding RNA TUSC8 inhibits breast cancer growth and metastasis via hsa-miR-190b-5p/MYLIP axis.[J] .Aging (Albany NY), 2020, 12: 2974-2991.

33. Pietrus Miłosz,Seweryn Michał,Kapusta Przemysław et al. Low Expression of miR-375 and hsa-miR-190b Differentiates Grade 3 Patients with Endometrial Cancer.[J] .Biomolecules, 2021, 11: undefined.

34.Wei M-Y,Lv R-R,Teng Z,Circular RNA circHIPK3 as a novel circRNA regulator of autophagy and endothelial cell dysfunction in atherosclerosis.[J] .Eur Rev Med Pharmacol Sci, 2020, 24: 12849-12858.

35. Pei Xiaoxi,Li Yucheng,Zhu Liangfu et al. Astrocyte-derived exosomes transfer hsa-miR-190b to inhibit oxygen and glucose deprivation-induced autophagy and neuronal apoptosis.[J] .Cell Cycle, 2020, 19: 906-917.

36.Gong Peng-Ju,Shao You-Cheng,Huang Si-Rui et al. Hypoxia-Associated Prognostic Markers and Competing Endogenous RNA Co-Expression Networks in Breast Cancer.[J] .Front Oncol, 2020, 10: 579868.

37. Minchenko Dmytro O,Insulin resistance in obese adolescents affects the expression of genes associated with immune response.[J] .Endocr Regul, 2019, 53: 71-82.

No competing interests reported.

PDF

Version 1

posted 17 Nov, 2021

You are reading this latest preprint version

Down-Regulated hsa-miR-190b-5p is Correlated With BCL11A Expression in Pediatric β-Thalassemia

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1