Progesterone Inhibits LPS-Induced Oxidative Stress Through Nrf2/Keap1 Pathway in Bovine Endometrial Epithelial Cells

doi:10.21203/rs.3.rs-1021821/v1

PDF

Research Article

Progesterone Inhibits LPS-Induced Oxidative Stress Through Nrf2/Keap1 Pathway in Bovine Endometrial Epithelial Cells

https://doi.org/10.21203/rs.3.rs-1021821/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 02 Nov, 2021

You are reading this latest preprint version

Background

Postpartum uterine infection can lead to endometrial inflammation and oxidative damage. Progesterone makes the animal more susceptible to uterine infection. Progesterone has been proved to play an anti-inflammatory role in inhibiting uterine innate immunity, and to reduce tissue oxidative damage. But the effect of progesterone on the oxidative damage of bovine endometrium has not been reported. The purpose of this study was to explore the effect and mechanism of progesterone (1, 3, and 5 ng/mL) on oxidative damage in primary bovine endometrial epithelial cells (BEEC) induced by lipopolysaccharide (LPS) from Escherichia coli.

Results

Compared with the LPS group, there were decreases (P < 0.05) in the levels of reactive oxygen and malondialdehyde, and increases (P < 0.05) in the activities of superoxide dismutase and catalase, and total antioxidant capacity in the cotreatment groups of progesterone and LPS. The cotreatment of LPS and P4 upregulated (P < 0.05) the mRNA abundance of antioxidant genes and the key protein levels in Nrf2/Keap1 pathway, and promoted the Nrf2 protein to enter the nucleus. The use of progesterone receptor antagonist mifepristone reversed the antioxidative effect of progesterone.

Conclusions

Progesterone protects BEEC from LPS-induced oxidative damage by activating Nrf2/Keap1 pathway through progesterone receptor.

Veterinary Epidemiology

progesterone

oxidative stress

lipopolysaccharide

bovine endometrial epithelial cells

Nrf2/Keap1

In the modern dairy industry, endometritis is one of the common postpartum diseases of dairy cows, and can lead to infertility and even death [1]. The disease is mainly caused by the invasion of pathogens such as Escherichia coli into the endometrium [2]. Lipopolysaccharide (LPS) is a component of the outer membrane of Gram-negative bacteria, and can induce inflammatory response. It can be used as a non-specific immune stimulant to produce inflammatory mediators and cytokines [3]. The release of some cytokines such as nitric oxide is involved in the pathogenesis of endometritis, resulting in oxidative damage [4].

Oxidative stress refers to the imbalance between oxidation and antioxidation in bodies. When the cells cannot remove the excess free radicals themselves in time, the accumulation of a large number of oxidation intermediates aggravates the damage,which has negative effects on animal production and health [5]. Reactive oxygen species (ROS) is a marker product of cell oxidative damage. Zhao et al.[6] found that ROS caused oxidative damage of Marc-145 cells by increasing inducible nitric oxide synthase and upregulating apoptotic genes. ROS can attack the phospholipid layer of biofilm to produce malondialdehyde (MDA)[5, 7] and inhibit the activity of antioxidant enzymes such as glutathione peroxidase (GSH- PX)[8]. It has been found that 1 µg/mL LPS increased ROS level and reduced GSH activity in bovine mammary epithelial cells [9].

Progesterone (P4) has the functions of maintaining pregnancy, thickening the endometrium, and inhibiting the maternal immune rejection to the fetus [10]. It plays an important role in maintaining the sexual cycle and pregnancy [11]. The pathogenesis of endometritis can be related to progesterone. In the presence of persistent corpus luteum, the postpartum progesterone concentration can exceed 5 ng/mL for more than 20 days, and persistent high concentrations of progesterone makes the uterus more susceptible to infection [12]. Studies have confirmed that progesterone may play a neuroprotective role on the developing brain by reducing lipid peroxidation and fighting free radicals [13]. Wu et al.[14] found that progesterone reduced oxidative damage and apoptosis of nerve cells induced by Aβ (25-35) through progesterone receptor membrane component 1 in mice. P4 also plays a regulatory role in uterine innate immunity [15], and has been shown to inhibit LPS-induced inflammatory factors and oxidative damage in human endometrium [16].

Nuclear factor erythroid 2 related factor 2 (Nrf2) is a new cellular antioxidant regulator [17]. Nrf2 is activated through Keap1 dependent disinhibition signaling mechanism [18, 19]. Activated Nrf2 mediates the expression of a series of antioxidant enzymes and signal proteins and plays an important role in regulating drug metabolism, antioxidant defense and oxidant signal [20–22]. Lin et al.[23, 24] found that curcumin can alleviate oxidative damage of RAW264.7 cells by activating Nrf2 pathway, and that Nrf2 knockout mice were more susceptible to diseases related to oxidative pathology. It has been found that 1 µg/mL LPS enhanced the mRNA abundance of inflammatory factors and induced activation of Nrf2 in bovine endometrial epithelial cells [25, 26]. Similarly, LPS can cause apoptosis of bovine mammary epithelium and activation of Nrf2 pathway [21]. Studies have shown that Nrf2/Keap1 pathway may participate in the multi-effect neuroprotective effect of P4 on traumatic brain injury, so as to reduce brain edema, apoptosis and inflammatory response after traumatic brain injury [27, 28]. As mentioned above, progesterone can regulate uterine immunity and alleviate oxidative damage of nerve cells. However, the mechanism of P4 on LPS-induced oxidative damage of bovine endometrium is not clear.

The purpose of this study was to explore the effect of progesterone on the oxidative damage of primary bovine endometrial epithelial cells (BEEC). BEEC was treated with LPS to induce the oxidative damage. The changes in oxidative damage markers, antioxidative enzyme activities, the mRNA transcriptions, and key proteins of Nrf2/Keap1 pathway were determined. Progesterone receptor antagonist mifepristone (RU486) was used to explore the potential mechanism.

2.1 Effects of Progesterone on ROS Level

As shown in Figure 1, the level of ROS increased (P < 0.01) after LPS challenge. Compared with the LPS group, the addition of 3 ng/mL P4 decreased (P < 0.05) the ROS level in BEEC.

2.2 Effects of Progesterone on Levels of MDA, SOD, and T-AOC

As shown in Figure 2, LPS stimulation caused increased (P < 0.01) content of MDA, and decreased (P < 0.05) activities of SOD, CAT, and T-AOC. Compared with the LPS group, the content of MDA decreased (P < 0.01), and the activities of SOD, CAT, and T-AOC increased (P < 0.05) in the cotreatment groups of LPS and P4 (1 and 3 ng/mL). No difference (P > 0.05) was observed between the LPS group and the cotreatment group of LPS and 5 ng/mL P4.

2.3 Effects of Progesterone on the mRNA Expressions of Antioxidative Genes

As depicted in Figure3, the cells treated with LPS showed decreased (P < 0.05) mRNA abundance of NFE2L2, HMOX1, NQO1, GCLC, and GPX2, and increased (P < 0.05) mRNA abundance of KEAP1 as compared with the blank control. The changes in GSTP1 was not obvious (P > 0.05). Compared with the cells treated with LPS, the gene expressions of NFE2L2, HMOX1, NQO1, GCLC, and GPX2 were generally higher (P < 0.05) in cells cotreated with LPS and P4 (1 and 3 ng/mL), but not the cells cotreated with LPS and 5 ng/mL P4 (P > 0.05).

2.4 Effects of Progesterone on the Key Protein Levels of Nrf2/Keap1 Pathway

The effects of progesterone on the protein levels of Nrf2, Keap1, NQO1, and HO-1 were detected using western blot (Figure 4). LPS caused decreases (P < 0.05) in the expressions of total Nrf2 protein and downstream HO-1 and NQO1 protein, and an increase (P < 0.05) in the content of Keap1 protein in BEEC as compared with the blank control. The Nrf2 protein in the nucleus in LPS group was higher (P < 0.05) than that in the control group. The protein expressions of total Nrf2, Nrf2 in nucleus, NQO1, and HO-1 was higher (P < 0.05) in LPS and P4 cotreatment group than those in the LPS group.

2.5 Effects of Progesterone on Nrf2 Translocation in BEEC

As shown in Figure 9, LPS treatment increased the number of Nrf2 in the nucleus. Co-treatment of progesterone with LPS showed higher level of Nrf2 in the nucleus as compared with the LPS group.

2.6 Effects of RU486 on Nrf2 Translocation in BEEC

As depicted in Figure 5 and 6, the cotreatment of LPS, P4 (3 ng/mL), and RU486 (35 ng/mL) caused increased (P < 0.05) levels of ROS and MDA, and decreased (P < 0.05) activities of SOD, CAT, and T-AOC as compared with the cells cotreated with LPS and P4 (3 ng/mL). There were decreases (P< 0.05) in the relative abundances of antioxidative genes in Nrf2 pathway after the addition of RU486 (Figure 7). As shown in Figure 8, the amount of total Nrf2, Nrf2 in nuclear, NQO1, and HO-1 were less (P < 0.05) in cells cotreated with LPS, P4 (3 ng/mL), and RU486 (35ng/mL) than those cotreated with LPS and P4. Similarly, RU486 reduced the level Nrf2 in the nucleus in cells cotreated with LPS and P4 (Figure 9).

In the present study, we reported that progesterone inhibited the production of ROS, and promoted the activity of antioxidant enzymes to protect BEEC from LPS-induced oxidative damage. Progesterone activated the Nrf2/Keap1 pathway, and promoted the entry of Nrf2 into the nucleus. This antioxidant effect was most prominent in P4 of 1 and 3 ng/mL, not 5 ng/mL. The addition of progesterone receptor antagonist RU486 inhibited the antioxidant effect of P4.

The excessive accumulation of ROS is one of the important signs of oxidative injury. The antioxidant enzyme system is the first line of defense against damage [29]. It has been found that LPS stimulated ROS production and inhibited the activities of antioxidant enzymes in BEEC and bovine mammary epithelial cells [30, 31]. Our data were consistent with these studies, indicating the oxidative damage of BEEC induced by LPS. We found that the production of ROS and MDA decreased after P4 treatment in LPS-stimulated BEEC. This was consistent with the results of previous reports in vitro that progesterone can eliminate MDA and protect against oxidative damage in mouse nerve cells [31]. In order to study the relationship between ROS clearance and P4 antioxidant capacity, we detected the activities of some enzymes in the antioxidant enzyme system. The results showed that the activities of SOD, CAT, and T-AOC increased after the addition of P4. Therefore, we speculated that progesterone may relieve injury by enhancing the activity of antioxidant enzyme system and reducing the level of ROS.

Nrf2/Keap1 signaling pathway is a key pathway regulating the expression of antioxidant enzymes and protect cells from oxidation induced cytotoxicity [32, 33]. Under normal physiological conditions, Nrf2 is anchored in the cytoplasm through Keap1 dependent ubiquitination proteasome degradation to maintain antioxidant and cytoprotective enzymes at basal level and to keep cellular homeostasis [34, 35]. The modification of key cysteine thiols and/or the phosphorylation of electrophiles and oxidants leads to the activation of Nrf2, and prompts Keap1 to release Nrf2, and finally Nrf2 enters the nucleus [36]. Nrf2 regulates the antioxidant defense system through a variety of mechanisms, including the regeneration of oxidative cofactors and proteins, the synthesis of reducing factors, the increase in redox transports, and the induction of stress response proteins. As a stress response protein, HO-1 can enhance antioxidant activity and maintain redox homeostasis. The role of HO-1 in redox transport, such as cystine/glutamate transport, is mainly supported by cystine transporter [37, 38]. HO-1 has the ability to regulate cellular redox defense to maintain redox homeostasis [39, 40]. NQO1 is an important reductant that regulates transcription through anti-oxidative response element (ARE)[41–44]. The combination of the activated Nrf2 and ARE promotes the expression of antioxidant genes such as NQO1 and HO-1, and further enhances the activity of antioxidant enzymes [41]. In this study, we detected the decreased levels of HO-1, NQO1, and total Nrf2, the increased Keap1 level and translocation of nuclear Nrf2 in BEEC after LPS stimulation. The downregulation of the downstream antioxidant genes of Nrf2 pathway, including NFE2L2, HMOX1, NQO1, GPX2, GCLC, and GSTP1, was consistent with the Western blot result. HMOX1 and NQO1 have significant effects on maintaining the redox balance of BEEC. The activities of HMOX1 and NQO1 are regulated by NFE2L2 [45]. It has been reported that Nrf2 is an important factor to promote the gene transcription of biosynthesis key enzymes (GSH -synthase and SLC7A11), GSH reductase and GPx4, and protect mouse nerve cells from ferroptosis caused by oxidative stress [46, 47]. Our results suggested the LPS-induced oxidative stress and the activation of Nrf2 pathway in BEEC. Similarly, it has been reported that LPS induced inflammation and oxidative stress in bovine endothelial cell line [36].

We observed that the addition of 1 and 3 ng/mL P4 promoted the activation Nrf2 pathway and the expressions of the downstream antioxidant genes and proteins in BEEC with oxidative stress response, which was in agreement with the report that progesterone reduced oxidative injury in experimental colitis in rats [48]. These results revealed that 1 and 3 ng/mL P4 inhibited LPS-induced oxidative stress in BEEC. Progesterone plays its role through progesterone receptor (PR). Mifepristone (RU486) is a specific inhibitor of PR. RU486 was used to verify the effect of progesterone in BEEC. We observed that RU486 reversed the antioxidant effect of progesterone, indicating that the antioxidant effect of P4(1 and 3 ng/mL) was mediated by PR.

In our study, the addition of 5 ng/mL progesterone had no obvious antioxidative effect in BEEC. In the study of vascular endothelial progenitor cells, it has been found that low concentration of progesterone (3.2 ng/mL) enhanced the expression of progesterone receptors A and B, whereas high concentration of progesterone (5.68 ng/mL) inhibited the progesterone receptor expressions [49–51]. Kempisty et al.[52] suggested that early rise in P4 concentration (> 5 ng/mL) has a negative effect on embryo development because serum progesterone concentration over 5 ng/mL increases the risk of bacterial infection. Hill et al. [53–55] sets the progesterone threshold at 1.53~4.36 ng/mL, and found that the progesterone concentration over 4.36 ng/mL has a significant negative effect on DNA hypermethylation on endometrium and induced apoptosis and oxidative stress in endometrial cell. Therefore, it is possible that 5 ng/mL P4 reduces the expression of progesterone receptor as compared with 1 and 3 ng/mL P4. In addition, 5 ng/ml P4 makes the uterus more susceptible to infection and induces apoptosis in BEEC and finally aggravates oxidative damage. Further research is needed to clarify the underlying mechanism.

In conclusion, 1 and 3 ng/mL P4 inhibited the LPS-induced oxidative damage in primary bovine endometrial epithelial cells through activating Nrf2/Keap1 signaling pathway. This antioxidative effect of P4 was probably mediated by PR.

This study shown that 1 and 3 ng/mL P4 inhibited the LPS-induced oxidative damage in primary bovine endometrial epithelial cells through activating Nrf2/Keap1 signaling pathway. This antioxidative effect was probably mediated by PR.

5.1 Cell Culture

The primary bovine endometrial epithelial cells were isolated as described from Dong et al.[56]. The uterus of healthy nonpregnant cows was collected from the slaughterhouse using aseptic operation. It was necessary to ensure that the uterus was free of infection and disease. The uterine horns of healthy cows were collected and placed in an ice box at 4°C and were brought back to the laboratory. The uterine surface was disinfected with iodophor and 75% alcohol. Under sterile conditions, the uterine horn was cut into small pieces of 3~4 cm, and was rinsed repeatedly with phosphate-buffered saline (PBS, pH values from 7.2 to 7.4) containing 500 U/mL penicillin and 500 U/mL streptomycin. The uterine horn was cut longitudinally to expose the endometrial tissue. The endometrial tissue was put into 0.1% streptoproteinase (P5147, sigma, USA) and then diluted in DMEM/F-12 (D8900, sigma, USA) at 4°C for 18 h. We use a sterile scalpel to scrape the surface of endometrium to collect cells in the super clean bench. The obtained cell suspension was centrifuged at 100×g for 5 min and was washed with PBS for 3 times. The cells were resuspended in DMEM/F-12 containing 15% fetal bovine serum (Gibco, USA) and were cultured at 37°C with 5% CO₂. The medium was changed every 24 h for routine culture.

5.2 Experiment Design and Treatments

LPS (L6529) was from E. coli O55:B5. Progesterone (P0130) and RU486 (M8046) were purchased from Sigma-Aldrich. LPS lyophilized powder was dissolved in DMEM/F12 at a concentration of 1 mg/mL as stock solutions at -20°C. LPS was further diluted to 1 µg/mL by DMEM/F12 during experiment. Progesterone was configured to a storage concentration of 100 µg/mL using DMEM/F12. Under physiological conditions, the concentration of progesterone in cow serum ranges from 1.03 ng/mL to 5.1 ng/mL [57], so the final concentration of progesterone we selected was 1, 3 and 5 ng/mL. RU486 is an antagonist of progesterone receptor (PR). The 50% inhibition concentration of RU486 as a progesterone receptor inhibitor was 0.2 nM [58]. RU486 was dissolved in ethanol and was stored at -20°C with the concentration of 118.5 µg/mL. RU486 was further diluted to 35 ng/mL with DMEM/F12 during the experiment. To determine the effect of P4 on the LPS-induced oxidative damage of BEEC, the cells were treated with LPS (1 µg/mL), or cotreated with LPS and P4 (1, 3, and 5 ng/mL). RU486 was used to further explore the potential mechanism of P4 on the oxidative damage. The cells were treated with RU486 (35ng/mL) or cotreated with LPS, P4 (3 ng/mL), and RU486 (35 ng/mL). To detect the oxidative markers, the cells were collected 12 h after treatment. For the detection of the gene expressions, the cells were collected at 6, 12, and 24 h. To detect the key protein levels of the Nrf2/Keap1 signaling pathway, the cells were collected at 90 min. The selection of time point was based on the pre-experimental results.

5.3 Reactive Oxygen Species Evaluation

The level of ROS was detected using fluorescent probe DCFH-DA combined with flow cytometry (FACS Calibur, BD Biosciences). According to the instruction of the kit (Reactive Oxygen Species Assay Kit, Beyotime, Beijing, China), the BEEC were inoculated in six-well plates and were treated according to the experiment design. Then the cells were collected and washed with PBS for three times, followed by the addition of the probe containing DCFH-DA (10 µM). The cells were incubated in 37°C cell incubator for 30 min. Then the cells were washed three times with serum-free cell culture medium. Flow cytometry was performed using 488 nm excitation wavelength and 525 nm emission wavelength. Data analysis was performed using the FlowJo software V10.0 (Ashland, KY, USA).

5.4 Determination of MDA, SOD, CAT and T-AOC

After treatment for 12 h, the collected cells were lysed by ultrasound on ice and then centrifuged at 6000×g for 10 min at 4°C. The supernatant was collected for oxidative damage labeling and antioxidant enzyme activity analysis. The MDA (A003-4-1), SOD (A001-3-2), CAT (A007-1-1), and T-AOC (A015-2-1) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute.

5.5 RNA Extraction and Quantitative PCR

The cells were inoculated in a six-well plate. Total RNA was extracted using Trizol reagent (ET111, Tran, China) after treatment. The quantity and purity of RNA was detected by a Nanodrop 2000 spectrophotometer (Thermo, USA). The RNA absorption ratios (A260/A280) between 1.8 and 2.1 can be used for subsequent experiments. The total RNA was converted into cDNA using the primescript RT Regent kit gDNA eraser (DRR047A, Takara, Japan). Real-time PCR was used to detect the expression of mRNA according to SYBR Premix Ex Taq™ II (RR820A, TaKaRa, Japan) on the CFX 96 Real-Time PCR Detection System (BIO-RAD, USA). The SYBR Premix, primers of target gene and template DNA were added into the amplification mixtures. The following cycling conditions were performed: 95°C for 2 min; 95°C for 5 s and 60°C for 34 s, 40 cycles; 95°C for 15 s; 60°C for 5 s; 60°C~95°C, 0.5°C gradient heating. The 2^−△△Ct method was carried out to measure the relative abundance of mRNA transcripts. A single product was amplified by each primer pair. The products were purified and sequenced (TsingKe Biotech, Beijing, China), and then the sequence results were analysed through BLAST (http://blast.ncbi.nlm.nih.gov/blast.cg) and compared to GenBank database. The sequences of primers were shown in Table 1.

Table 1

Primer sequences used for quantitative real−time PCR
Gene	Primer sequence (5′ → 3′)	Length (bp)	NCBI accession
NFE2L2	F: CCCAGTCTTCACTGCTCCTC R: TCAGCCAGCTTGTCATTTTG	165	NM_001011678.2
KEAP1	F: TCACCAGGGAAGGATCTACG R: AGCGGCTCAACAGGTACAGT	199	NM_001101142.1
HMOX1	F: GGCAGCAAGGTGCAAGA R: GAAGGAAGCCAGCCAAGAG	221	NM_001014912.1
NQO1	F: AACCAACAGACCAGCCAATC R: CACAGTGACCTCCCATCCTT	154	NM_001034535.1
GPX2	F: CTTCAACCTGTCCTCCCT R: GGTCATTCATCTGGGTGT	98	NM_174076.3
GCLC	F: ATTGGGTGGAGAGTGGAA R: ACAGCGGGATGAGAAAGT	133	NM_001083674
GSTP1	F: TTTGCGGACTACAACCTG R: CCCTCACTGTTTCCCATT	186	NM_177516.1
ACTB	F: CAGCAAGCAGGAGTACGATGAG R: AAGGGTGTAACGCAGCTAACAGT	85	NM_173979.3

5.6 Western Blot Assay

Total protein and nuclear protein were extracted separately. Ripa lysate (P0013b, Beyotime, China) was used for total protein, and its main component was 50 mM Tris (pH7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxyholate, 0.1% SDS, sodium orthovanadate, sodium fluoride, EDTA, leupeptin and other inhibitors. Nuclear protein was extracted by nuclear protein and cytoplasmic protein extraction kit (P0013b, Beyotime, China). Both were quantified by BCA protein assay kit (Beyotime, China). The quantified protein (20~30 µg) was separated on 10% SDS polyacrylamide gel after electrophoresis, and was transferred to a PVDF membrane. The PVDF membrane was incubated in 5% skimmed milk for 1.5 h at room temperature. After completion of the sealing, the PVDF membrane was washed with TBST (0.05% Tween-20 Tris-HCl buffer) for six times with each 5 min. Then the PVDF membranes were incubated with corresponding primary antibodies specific for Nrf2 (#12721, Cell Signaling Technology, USA), Keap1 (ab227828, Abcam, UK), HO-1 (ab227828, Abcam, UK), NQO1 (ab80588, Abcam, UK), LaminB1(#13435, Cell Signaling Technology, USA) and β-actin (#4970, Cell Signaling Technology, USA) at 4°C overnight. These antibodies were diluted to 1:1000 with 5% bovine serum albumin. Then the PVDF membrane was incubated with the secondary antibody (diluted to 1:2000 with 5% skimmed milk) for 1.5 h at room temperature. The protein bands were detected using a chemiluminescence assay. The antigen-antibody complexes were visualized on horseradish peroxidase substrate (Millipore, Billerica, MA, USA) by ChemiScope 5300Pro CCD camera (Clinx Science Instruments, Shanghai, China). The band intensity was quantified by Quantity One software (Bio-Rad, California, USA).

5.7 Immunofluorescence Staining

The cells were inoculated into a 24-well plate and was treated according to the experiment design. Then the cells were covered with 4% formaldehyde to a depth of 2~3 mm. The cells were fixed at room temperature for 15 min and was washed with PBS three times with each 5 min. Then the cell membrane was penetrated with 0.4% Triton X-100 (ST797, Beyotime, China) for 15 min. After washing with PBS, the cells were blocked in blocking buffer (5% BSA) for 60 min at room temperature. The primary antibody for Nrf2 (dilution ratio 1:200) was prepared in antibody dilution buffer (5% BSA). The cells were incubated with primary antibody at 4°C overnight and were washed with PBS three times with each 5 min. The fluorescein coupled secondary antibody (A0423, beyotime, China) was diluted with antibody dilution buffer, and the cells were incubated in dark for 1.5 h at room temperature. The nuclei were stained with DAPI (C1005, Beyotime, China). The fluorescence microscope (Leica TCS Sp8, Leica company, Germany) was used for observation.

5.8 Statistical Analysis

The experiment was repeated at least three times. All data were analyzed using the SPSS-Statistics 21.0 software (IBM, NY, USA). Statistically significant differences were calculated by one-way ANOVA, followed by Dunnett’s test. The data were presented as means ± standard error of the means (SEM). A two-sided P < 0.05 was considered statistically significant.

BEEC: Bovine endometrial epithelial cells; LPS: lipopolysaccharide; ROS: Reactive oxygen species; MDA: malondialdehyde; GSH-PX: glutathione peroxidase；P4: Progesterone; ARE: anti-oxidative response element; PR: progesterone receptor; DMEM/F-12: Dulbeccos’s Modified Eagle Media/Nutrient Mixture F-12; cDNA: Complementary DNA; E.coli: Escherichia coli; qPCR: Quantitative polymerase chain reaction; DCFH-DA: 2,7-Dichlorodihy drofluorescein diacetate; SOD: Superoxide Dismutase; CAT: Catalase; T-AOC: Total antioxidant capacity; BSA: Bovine serum albumin; PVDF: Poly(vinylidene fluoride).

Ethics approval and consent to participate

This study was conducted according to the guidelines of College of Veterinary Medicine, Yangzhou University.

Consent for publication

Not applicable

Competing interests

The authors declared that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Authors’ contributions

LC conceived and designed the study. QZ performed the experiments and wrote the manuscript. QZ and JZ analyzed the data. HW, JD, JL, JJL, and CQ supervised and edited the article. All authors contributed to the article and approved the final version of the article.

Funding

This work was supported by the National Natural Science Foundation of China (NO: 32072937, 31802253, 32102735); the China Postdoctoral Science Foundation (NO: 2018M632398); the earmarked fund for Jiangsu Agricultural Industry Technology System (JATS[2021]499); the Natural Science Foundation of Jiangsu Province (NO: BK20210808); and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD); the Topnotch Academic Programs Project of Jiangsu Higher Education Institutions (TAPP).

Availability of data and materials

All datasets presented in the study are available from LC, QZ and JJL on request.

Acknowledgements

Not applicable

Wagener K, Gabler C, Drillich M: A review of the ongoing discussion about definition, diagnosis and pathomechanism of subclinical endometritis in dairy cows. Theriogenology 2017, 94:21-30.
Cheong SH, Nydam DV, Galvao KN, Crosier BM, Ricci A, Caixeta LS, Sper RB, Fraga M, Gilbert RO: Use of reagent test strips for diagnosis of endometritis in dairy cows. Theriogenology 2012, 77(5):858-864.
Cui L, Wang H, Lin J, Wang Y, Dong J, Li J, Li J: Progesterone inhibits inflammatory response in E.coli- or LPS-Stimulated bovine endometrial epithelial cells by NF-κB and MAPK pathways. Dev Comp Immunol 2020, 105:103568.
Webster KM, Wright DK, Sun M, Semple BD, Ozturk E, Stein DG, O'Brien TJ, Shultz SR: Progesterone treatment reduces neuroinflammation, oxidative stress and brain damage and improves long-term outcomes in a rat model of repeated mild traumatic brain injury. J Neuroinflammation 2015, 12:238.
Dandekar A, Mendez R, Zhang K: Cross talk between ER stress, oxidative stress, and inflammation in health and disease. Methods Mol Biol 2015, 1292:205-214.
Liu X, Song Z, Bai J, Nauwynck H, Zhao Y, Jiang P: Xanthohumol inhibits PRRSV proliferation and alleviates oxidative stress induced by PRRSV via the Nrf2-HMOX1 axis. Vet Res 2019, 50(1):61.
Newsholme P, Cruzat VF, Keane KN, Carlessi R, de Bittencourt PI, Jr.: Molecular mechanisms of ROS production and oxidative stress in diabetes. Biochem J 2016, 473(24):4527-4550.
Stukelj M, Toplak I, Svete AN: Blood antioxidant enzymes (SOD, GPX), biochemical and haematological parameters in pigs naturally infected with porcine reproductive and respiratory syndrome virus. Pol J Vet Sci 2013, 16(2):369-376.
Filomeni G, De Zio D, Cecconi F: Oxidative stress and autophagy: the clash between damage and metabolic needs. Cell Death Differ 2015, 22(3):377-388.
Fusco R, Cordaro M, Siracusa R, Peritore AF, D'Amico R, Licata P, Crupi R, Gugliandolo E: Effects of Hydroxytyrosol against Lipopolysaccharide-Induced Inflammation and Oxidative Stress in Bovine Mammary Epithelial Cells: A Natural Therapeutic Tool for Bovine Mastitis. Antioxidants (Basel) 2020, 9(8).
Lee SM, Kleiboeker SB: Porcine reproductive and respiratory syndrome virus induces apoptosis through a mitochondria-mediated pathway. Virology 2007, 365(2):419-434.
Standeven LR, McEvoy KO, Osborne LM: Progesterone, reproduction, and psychiatric illness. Best Pract Res Clin Obstet Gynaecol 2020, 69:108-126.
Ranasinghe RM, Nakao T, Yamada K, Koike K, Hayashi A, Dematawewa CM: Characteristics of prolonged luteal phase identified by milk progesterone concentrations and its effects on reproductive performance in Holstein cows. J Dairy Sci 2011, 94(1):116-127.
Guennoun R: Progesterone in the Brain: Hormone, Neurosteroid and Neuroprotectant. Int J Mol Sci 2020, 21(15).
Singh M, Su C: Progesterone and neuroprotection. Horm Behav 2013, 63(2):284-290.
Liu S, Wu H, Xue G, Ma X, Wu J, Qin Y, Hou Y: Metabolic alteration of neuroactive steroids and protective effect of progesterone in Alzheimer's disease-like rats. Neural Regen Res 2013, 8(30):2800-2810.
Thomas P, Pang Y: Protective actions of progesterone in the cardiovascular system: potential role of membrane progesterone receptors (mPRs) in mediating rapid effects. Steroids 2013, 78(6):583-588.
Kong X, Li M, Shao K, Yang Y, Wang Q, Cai M: Progesterone induces cell apoptosis via the CACNA2D3/Ca2+/p38 MAPK pathway in endometrial cancer. Oncol Rep 2020, 43(1):121-132.
Loboda A, Damulewicz M, Pyza E, Jozkowicz A, Dulak J: Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cell Mol Life Sci 2016, 73(17):3221-3247.
Shukla V, Kaushal JB, Sankhwar P, Manohar M, Dwivedi A: Inhibition of TPPP3 attenuates β-catenin/NF-κB/COX-2 signaling in endometrial stromal cells and impairs decidualization. J Endocrinol 2019, 240(3):417-429.
Zhang Y, Gordon GB: A strategy for cancer prevention: stimulation of the Nrf2-ARE signaling pathway. Mol Cancer Ther 2004, 3(7):885-893.
Buendia I, Michalska P, Navarro E, Gameiro I, Egea J, León R: Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther 2016, 157:84-104.
Tristan M, Orozco LJ, Steed A, Ramírez-Morera A, Stone P: Mifepristone for uterine fibroids. Cochrane Database Syst Rev 2012, 2012(8):Cd007687.
Gong Y, Yang Y: Activation of Nrf2/AREs-mediated antioxidant signalling, and suppression of profibrotic TGF-β1/Smad3 pathway: a promising therapeutic strategy for hepatic fibrosis - A review. Life Sci 2020, 256:117909.
Fu K, Chen H, Wang Z, Cao R: Andrographolide attenuates inflammatory response induced by LPS via activating Nrf2 signaling pathway in bovine endometrial epithelial cells. Res Vet Sci 2021, 134:36-41.
Arbab AAI, Lu X, Abdalla IM, Idris AA, Chen Z, Li M, Mao Y, Xu T, Yang Z: Metformin Inhibits Lipoteichoic Acid-Induced Oxidative Stress and Inflammation Through AMPK/NRF2/NF-κB Signaling Pathway in Bovine Mammary Epithelial Cells. Front Vet Sci 2021, 8:661380.
Zhang M, Wu J, Ding H, Wu W, Xiao G: Progesterone Provides the Pleiotropic Neuroprotective Effect on Traumatic Brain Injury Through the Nrf2/ARE Signaling Pathway. Neurocrit Care 2017, 26(2):292-300.
Lin X, Bai D, Wei Z, Zhang Y, Huang Y, Deng H, Huang X: Curcumin attenuates oxidative stress in RAW264.7 cells by increasing the activity of antioxidant enzymes and activating the Nrf2-Keap1 pathway. PLoS One 2019, 14(5):e0216711.
Javanbakht MH, Djalali M, Daneshpazhooh M, Zarei M, Eshraghian MR, Derakhshanian H, Chams-Davatchi C: Evaluation of antioxidant enzyme activity and antioxidant capacity in patients with newly diagnosed pemphigus vulgaris. Clin Exp Dermatol 2015, 40(3):313-317.
Fu K, Wang Z, Cao R: Berberine attenuates the inflammatory response by activating the Keap1/Nrf2 signaling pathway in bovine endometrial epithelial cells. Int Immunopharmacol 2021, 96:107738.
Huang Y, Shen L, Jiang J, Xu Q, Luo Z, Luo Q, Yu S, Yao X, Ren Z, Hu Y et al: Metabolomic Profiles of Bovine Mammary Epithelial Cells Stimulated by Lipopolysaccharide. Sci Rep 2019, 9(1):19131.
Coronel MF, Labombarda F, Roig P, Villar MJ, De Nicola AF, González SL: Progesterone prevents nerve injury-induced allodynia and spinal NMDA receptor upregulation in rats. Pain Med 2011, 12(8):1249-1261.
Li XS, Tang XY, Su W, Li X: Vitexin protects melanocytes from oxidative stress via activating MAPK-Nrf2/ARE pathway. Immunopharmacol Immunotoxicol 2020, 42(6):594-603.
Baird L, Yamamoto M: The Molecular Mechanisms Regulating the KEAP1-NRF2 Pathway. Mol Cell Biol 2020, 40(13).
Lu MC, Ji JA, Jiang ZY, You QD: The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med Res Rev 2016, 36(5):924-963.
Wan FC, Zhang C, Jin Q, Wei C, Zhao HB, Zhang XL, You W, Liu XM, Liu GF, Liu YF et al: Protective effects of astaxanthin on lipopolysaccharide-induced inflammation in bovine endometrial epithelial cells†. Biol Reprod 2020, 102(2):339-347.
Daher B, Parks SK, Durivault J, Cormerais Y, Baidarjad H, Tambutte E, Pouysségur J, Vučetić M: Genetic Ablation of the Cystine Transporter xCT in PDAC Cells Inhibits mTORC1, Growth, Survival, and Tumor Formation via Nutrient and Oxidative Stresses. Cancer Res 2019, 79(15):3877-3890.
Park C, Lee H, Noh JS, Jin CY, Kim GY, Hyun JW, Leem SH, Choi YH: Hemistepsin A protects human keratinocytes against hydrogen peroxide-induced oxidative stress through activation of the Nrf2/HO-1 signaling pathway. Arch Biochem Biophys 2020, 691:108512.
Mou K, Pan W, Han D, Wen X, Cao F, Miao Y, Li P: Glycyrrhizin protects human melanocytes from H2O2‑induced oxidative damage via the Nrf2‑dependent induction of HO‑1. Int J Mol Med 2019, 44(1):253-261.
Singh SP, Greenberg M, Glick Y, Bellner L, Favero G, Rezzani R, Rodella LF, Agostinucci K, Shapiro JI, Abraham NG: Adipocyte Specific HO-1 Gene Therapy is Effective in Antioxidant Treatment of Insulin Resistance and Vascular Function in an Obese Mice Model. Antioxidants (Basel) 2020, 9(1).
Bey EA, Reinicke KE, Srougi MC, Varnes M, Anderson VE, Pink JJ, Li LS, Patel M, Cao L, Moore Z et al: Catalase abrogates β-lapachone-induced PARP1 hyperactivation-directed programmed necrosis in NQO1-positive breast cancers. Mol Cancer Ther 2013, 12(10):2110-2120.
Luo J, Yan D, Li S, Liu S, Zeng F, Cheung CW, Liu H, Irwin MG, Huang H, Xia Z: Allopurinol reduces oxidative stress and activates Nrf2/p62 to attenuate diabetic cardiomyopathy in rats. J Cell Mol Med 2020, 24(2):1760-1773.
Zhang K, Chen D, Ma K, Wu X, Hao H, Jiang S: NAD(P)H:Quinone Oxidoreductase 1 (NQO1) as a Therapeutic and Diagnostic Target in Cancer. J Med Chem 2018, 61(16):6983-7003.
Guo G, Gao Z, Tong M, Zhan D, Wang G, Wang Y, Qin J: NQO1 is a determinant for cellular sensitivity to anti-tumor agent Napabucasin. Am J Cancer Res 2020, 10(5):1442-1454.
Ren J, Su D, Li L, Cai H, Zhang M, Zhai J, Li M, Wu X, Hu K: Anti-inflammatory effects of Aureusidin in LPS-stimulated RAW264.7 macrophages via suppressing NF-κB and activating ROS- and MAPKs-dependent Nrf2/HO-1 signaling pathways. Toxicol Appl Pharmacol 2020, 387:114846.
Jin Y, Huang ZL, Li L, Yang Y, Wang CH, Wang ZT, Ji LL: Quercetin attenuates toosendanin-induced hepatotoxicity through inducing the Nrf2/GCL/GSH antioxidant signaling pathway. Acta Pharmacol Sin 2019, 40(1):75-85.
Zheng Y, Chen Z, She C, Lin Y, Hong Y, Shi L, Zhang Y, Cao P, Xu X: Four-octyl itaconate activates Nrf2 cascade to protect osteoblasts from hydrogen peroxide-induced oxidative injury. Cell Death Dis 2020, 11(9):772.
Karatepe O, Altiok M, Battal M, Kamali G, Kemik A, Aydin T, Karahan S: The effect of progesterone in the prevention of the chemically induced experimental colitis in rats. Acta Cir Bras 2012, 27(1):23-29.
Lee TS, Lin JJ, Huo YN, Lee WS: Progesterone Inhibits Endothelial Cell Migration Through Suppression of the Rho Activity Mediated by cSrc Activation. J Cell Biochem 2015, 116(7):1411-1418.
Matsubara Y, Matsubara K: Estrogen and progesterone play pivotal roles in endothelial progenitor cell proliferation. Reprod Biol Endocrinol 2012, 10:2.
Peluso JJ, Yuan A, Liu X, Lodde V: Plasminogen activator inhibitor 1 RNA-binding protein interacts with progesterone receptor membrane component 1 to regulate progesterone's ability to maintain the viability of spontaneously immortalized granulosa cells and rat granulosa cells. Biol Reprod 2013, 88(1):20.
Kempisty B, Wojtanowicz-Markiewicz K, Ziółkowska A, Budna J, Ciesiółka S, Piotrowska H, Bryja A, Antosik P, Bukowska D, Wollenhaupt K et al: Association between progesterone and estradiol-17beta treatment and protein expression of pgr and PGRMC1 in porcine luminal epithelial cells: a real-time cell proliferation approach. J Biol Regul Homeost Agents 2015, 29(1):39-50.
Xiong Y, Hu L, Zhang T, Wang M, Xu H, Li TC, Sun Y, Wang CC: Effects of high progesterone in in-vitro fertilization cycle on DNA methylation and gene expression of adhesion molecules on endometrium during implantation window. J Assist Reprod Genet 2020, 37(1):33-43.
Xiong Y, Wang J, Liu L, Chen X, Xu H, Li TC, Wang CC, Zhang S: Effects of high progesterone level on the day of human chorionic gonadotrophin administration in in vitro fertilization cycles on epigenetic modification of endometrium in the peri-implantation period. Fertil Steril 2017, 108(2):269-276.e261.
Chen X, Jin X, Liu L, Man CW, Huang J, Wang CC, Zhang S, Li TC: Differential expression of vascular endothelial growth factor angiogenic factors in different endometrial compartments in women who have an elevated progesterone level before oocyte retrieval, during in vitro fertilization-embryo transfer treatment. Fertil Steril 2015, 104(4):1030-1036.
Dong J, Li J, Cui L, Wang Y, Lin J, Qu Y, Wang H: Cortisol modulates inflammatory responses in LPS-stimulated RAW264.7 cells via the NF-κB and MAPK pathways. BMC Vet Res 2018, 14(1):30.
Siemieniuch MJ, Bowolaksono A, Skarzynski DJ, Okuda K: Ovarian steroids regulate prostaglandin secretion in the feline endometrium. Anim Reprod Sci 2010, 120(1-4):142-150.
Jiang W, Allan G, Fiordeliso JJ, Linton O, Tannenbaum P, Xu J, Zhu P, Gunnet J, Demarest K, Lundeen S et al: New progesterone receptor antagonists: phosphorus-containing 11beta-aryl-substituted steroids. Bioorg Med Chem 2006, 14(19):6726-6732.

No competing interests reported.

uncroppedimages.zip

PDF

Version 1

posted 02 Nov, 2021

You are reading this latest preprint version

Progesterone Inhibits LPS-Induced Oxidative Stress Through Nrf2/Keap1 Pathway in Bovine Endometrial Epithelial Cells

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1 Background

2 Results

2.1 Effects of Progesterone on ROS Level

2.2 Effects of Progesterone on Levels of MDA, SOD, and T-AOC

2.3 Effects of Progesterone on the mRNA Expressions of Antioxidative Genes

2.4 Effects of Progesterone on the Key Protein Levels of Nrf2/Keap1 Pathway

2.5 Effects of Progesterone on Nrf2 Translocation in BEEC

2.6 Effects of RU486 on Nrf2 Translocation in BEEC

3 Discussion

4 Conclusion

5 Methods

5.1 Cell Culture

5.2 Experiment Design and Treatments

5.3 Reactive Oxygen Species Evaluation

5.4 Determination of MDA, SOD, CAT and T-AOC

5.5 RNA Extraction and Quantitative PCR

5.6 Western Blot Assay

5.7 Immunofluorescence Staining

5.8 Statistical Analysis

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1