Cell culture and hypoxia treatment
Human cardiac microvascular endothelial cells (HCMECs) were purchased from ScienCell Laboratory (Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd., Shanghai, China). This cell line is commonly used for angiogenesis research. HCMECs were cultured in endothelial cell medium (ECM) supplemented with 5% FBS, 1% endothelial cell growth supplement and 1% penicillin–streptomycin solution (ScienCell, USA). The cells were cultured in an incubator at 37°C with 5% CO2. Hypoxic treatment was performed when HCMECs grew to 60%-70%. HCMECs were cultured in RPMI 1640 medium, and the cells were placed in a three-gas incubator containing 95% N2 and 5% CO2 for continuous hypoxia for 24 hours.
Oligonucleotide transfection
The circ-0010928 overexpression plasmid and negative control (NC) plasmid and miR-921-specific small interfering RNAs (siRNAs) and si-NC were constructed by Hanbio Biotechnology (Shanghai, China). According to the manufacturer’s instructions, all oligonucleotides were transfected into HCMECs at a final concentration of 50 nM using Lipofectamine 2000.
Quantitative real-time PCR (qRT-PCR)
TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from the cells. The PrimeScript™ RT reagent kit or Mir-X miR First-Strand Synthesis Kit (TaKaRa, Japan) was used to reverse transcribe total RNA into complementary DNA (cDNA). Then, PCR was performed with TB Green Premix Ex Taq II (TaKaRa, Japan) in an AB7500 thermocycler. GAPDH was used as the internal control for circ-0010928 and LSM14A. U6 was used as the internal control for miR-921, and the expression levels were calculated using the 2−ΔΔCt method. The primer sequences are shown in Table 1.
Table 1:
Gene name
|
Forward (5’>3’)
|
Reverse (5’>3’)
|
Circ-0010928
|
CTCATACCATGCCTGTGGTG
|
CTCGGACTTGTCCATTCGAT
|
GAPDH
|
CAGGAGGCATTGCTGATGAT
|
GAAGGCTGGGGCTCATTT
|
MiR-921
|
GAGGGACAGAACCAGGATTCAA
|
TCCTCCTCTCCTTCCTTCTC
|
U6
|
GGAACGATACAGAGAAGATTAGC
|
TGGAACGCTTCACGAATTTGCG
|
Luciferase reporter assay
The synthetic circ-0010928 sequence or LSM14A sequence containing the wild-type or mutant binding site of miR-921 was cloned into the dual luciferase reporter vector (Hanbio Biotechnology, Shanghai, China). The wild-type and mutant luciferase reporter gene plasmids and miR-921 mimics were co-transfected into 293T cells. After transfection, the cells were cultured for another 48 hours. Luciferase activity was measured by the Dual-Luciferase Reporter Assay System (Promega).
Cell Counting Kit-8 (CCK-8) assay
The cells were seeded in a 96-well plate at a density of 3 × 103/well and incubated at 37°C in a 5% CO2 incubator for 24 hours. Ten microlitres of CCK-8 solution (Dojindo Laboratories, Japan) was added to each well and incubated for 2 hours. Subsequently, optical density (OD) values at 450 nm were obtained using a microplate reader (Thermo Fisher Scientific, USA).
Tube formation assay
Matrigel (Corning, NY, USA) was placed into a 96-well plate at 100 µl per well, spread evenly on the bottom and placed at 37°C in a 5% CO2 incubator for 30 min. The cells were seeded in each well at a density of 3×105/ml, and tube formation was observed under an optical microscope (Olympus, Japan) 8 hours later.
Transwell assay
A 24-well plate with a Transwell chamber with an 8-µm pore size (BD, Franklin Lake, New Jersey, USA) was used to determine the cell migration ability. HCMECs (4×104 cells) were inoculated with 200 µl serum-free medium per well in the upper chamber, and 600 µl medium containing 10% FBS was added to the lower chamber. After 24 hours of incubation, the migrating cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Solarbio, Beijing, China). Then, the number of stained migrated cells was observed with a microscope.
Scratch assay
Lines were drawn parallel to the plate at the bottom of a six-well plate, and 3 marks were added for each well. The cells were inoculated in the six-well plate at 3×104/well and incubated at 37°C in a 5% CO2 incubator until the density was close to 95%. A 200-µl pipette tip was used perpendicular to the marked line to scratch the cell monolayer. After washing with PBS, medium containing 1% FBS was added and incubated again for 24 hours. The cell migration distance was observed under a microscope.
Flow cytometry for apoptosis and cell cycle analysis
An Annexin V-APC/7-AAD Apoptosis Kit (Multisciences, Hangzhou, China) and a Cell Cycle and Apoptosis Analysis Kit (Meilunbio, Dalian, China) were used to perform flow cytometry to analyse apoptosis and the cell cycle, respectively. The cells were seeded into a six-well plate at 3×104/well and incubated to reach a cell density of over 95%, after which the cells were digested into a cell suspension. For apoptosis experiments, the cells were resuspended in 500 µl buffer and incubated for 5 min in the dark with 10 µl 7-AAD and 5 µl APC. For the cell cycle experiments, the cells were fixed with 75% absolute ethanol. After 24 hours, 500 µl staining solution containing PI was added to each sample and incubated for 30 min at 37°C in the dark.
Statistical analyses
All data were analysed with SPSS 25.0 software (IBM, Somers, NY, USA) and are expressed as the mean ± standard deviation (M±SD). Student’s t-test was used to compare two different groups, and one-way ANOVA was used to compare multiple sets of data. A P-value less than 0.05 was considered statistically significant.