Animals
C57BL/6 female mice (6-8 wk) were purchased from Charles River (Montreal, Canada). IL-17KO mice were prepared as previously described11. All animals were treated and maintained under a protocol approved by the Animal Care Committee of McGill University, following guidelines set by the Canadian Council on Animal Use and Care.
Antigen Administration
Wild type and IL-17KO mice were exposed to purified HDM extract (Greer Laboratories, Lenoir, NC) intranasally (25 mg of protein in 10 ml of saline) for 5 days/week for five consecutive weeks. The equivalent volume of saline was used as the control. Each group contained 10 mice. The mice were killed at 24 h after the last exposure.
Preparation of bronchoalveolar lavage fluid
The lungs were lavaged using a cannula inserted in the trachea and the lungs were instilled with 0.5 ml PBS. Cytospins were prepared at a density of 0.5 ´ 106 cells/ml. Differential cell counts were performed using standard morphological criteria on Hema-Gurr-stained cytospins (500 cells/sample) (Merck, Darmstadt, Germany).
Bronchoalveolar lavage cytokine analysis
Aliquots of cell-free bronchoalveolar lavage fluid (BALF) were frozen in liquid N2 and stored at -80°C. The levels of IL-4, IL-5, IL-13, IL-10, TNF-a, IFN-g and KC in BALF were analyzed by the Bio-plex system (Bio-Rad, Mississauga, Ontario, Canada) performed in the Goodman Cancer Centre Transgenic Core Facility, McGill University, Canada.
Immunohistochemistry staining
The immunohistochemistry staining for IL-17A (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and a-SMA (Santa Cruz Biotechnology) was performed on paraffin-embedded mouse lung tissue sections as previously described 12.
miRNA expression array
Equal amount of RNA sample from each mice of different groups was pooled respectively for miRNA profiling assay using µParaflo®Microfluidic Biochip miRNA microarray (LC Sciences, Houston, USA).
Real-time quantitative RT-PCR
Independent assays were performed using quantitative reverse transcription PCR (qRT-PCR) on all mouse samples for individual miRNA (miR-207, miR-5112, miR-2861, miR-340-5p, miR-6238, miR-181c-5p, miR-6239, miR-365-3p and miR-133b-3p) (Qiagen, Hilden, Germany) and predicted target genes (FASL, TRAF3, ARRB2, Sgk1, PIK3R3, ADAM10 and ADM) (Bio-rad, Foster City, USA). Data were presented relative to U6 for miRNA and β-actin for target genes based on calculations of 2(−σσCt). The primer sequences for target genes were listed in Table 1. Statistical significance was defined as p < 0.05 as measured by the t-test using GraphPad Prism 5 software (GraphPad, San Diego, USA).
Table 1. The sequence of primers for real-time PCR
Gene
|
Sequence (5’-3’)
|
Direction
|
FASL
|
GAACTCCGTGAGCCAACCC
|
Forward
|
|
CCAGAGATCAGAGCGGTTCC
|
Reverse
|
TRAF3
|
GCGTGCCAAGAAAGCATCAT
|
Forward
|
|
CCTCTGCCTTCATTCCGACA
|
Reverse
|
ARRB2
|
ACACGCCACTTCCTCATGTC
|
Forward
|
|
TCTTCTTGACGGTCTTGGCA
|
Reverse
|
Sgk1
|
ATCCTGACCAAGCCGGACC
|
Forward
|
|
AAAATCGTTCAGGCCCATCCTT
|
Reverse
|
PIK3R3
|
AAGATGCAGAGTGGTACTGGG
|
Forward
|
|
CCTGCATTTTCGTTGAGGCA
|
Reverse
|
ADAM10
|
ACACCAAAAACACCAGCGTG
|
Forward
|
|
GGAAGTGTCCCTCTTCATTCGT
|
Reverse
|
ADM
|
ATTGGGTTCACTCGCTTTCCT
|
Forward
|
|
GCTGGATGCTTGTAGTTCCCT
|
Reverse
|
b-actin
|
GATGCCCTGAGGCTCTTTTCC
|
Forward
|
|
TCTTTACGGATGTCAACGTCACAC
|
Reverse
|
Mouse lung epithelial cell culture.
Mouse lung epithelial cells (MLE-12 cells), a distal bronchiolar and alveolar epithelial cell line (ATCC, Manassas, VA)13, were cultured in HITES medium (50:50, DMEM-Ham’s F-12) supplemented with 2% FBS, 2 mM L-glutamine, 10 mM HEPES, 1:100 insulin/transferrin/selenium supplement (Sigma, St. Louis, MO, USA) and antibiotics. After 24 h of starvation with HITES medium containing 0.1% FBS, cells were cultured with different concentrations (0, 1, 10 and 100ng/ml) of mouse recombinant IL-17A (R&D Systems, Minneapolis, USA) for 24h, and the expression of miR-365-3p was examined by qRT-PCR. Alternatively, the mimic (100nM) or inhibitor (100nM) of miR-365-3p was transfected into the cells by using X-tremeGENE siRNA Transfection Regent (Roche, Penzberg, Upper Bavaria, Germany) in Opti-MEM (Gibco, Grand Island, NY, USA) for 24h, the expression of ARRB2 was examined by qRT-PCR and Western blot.
Luciferase reporter assay
Sense and antisense sequences corresponding to a 406-bp fragment from the 3’UTR of ARRB2 with the predicted binding and mutated sites (position 236–243) were amplified from cDNAs of mouse lung tissue by using primers containing the SacI restriction site in the sense oligo and XbaI restriction site in the antisense oligo (Sense: 5’-ATCGAGCTCCTGTCCACCCGAGATACAC-3’; Antisense: 5’-AGCTCTAGAGGTACCCTGCAGATGTAGAA-3’; GenePharma, Shanghai, China). To construct luciferase reporter plasmids for ARRB2, the annealed synthetic oligos were cloned downstream to the firefly luciferase into SacI-XbaI double digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, WI, USA). For the luciferase reporter assay, 293-T cells (ATCC) were co-transfected with 250 ng of luciferase reporter plasmid harboring the wild type/mutant binding sites of ARRB2 respectively along with 25nM mimic control/miR-365-3p mimic using X-tremeGENE siRNA Transfection Regent (Roche) in Opti-MEM (Gibco). After 48h of transfection, cells were washed in PBS and lysed in Reporter lysis buffer (Promega), and luciferase activity was measured in a FlexStation 3 microplate reader (Molecular Devices, Sunnyvale, CA, USA) using the Dual-Luciferase reporter assay kit (Promega) according to the manufacturer's instructions. Firefly luciferase activity was normalized to Renilla luciferase activity, and relative luciferase activity was calculated taking firefly luciferase activity of empty pmirGLO transfected cells as 100 percent.
Western Blot
The protein samples of mouse lung tissue or MLE-12 cells were loaded (5 μg) on a 10% acrylamide SDS-PAGE gel (Bio-Rad, Hercules, USA) for protein separation, followed by transfer to PVDF membranes (Bio-Rad). The blots were then blocked with 1% BSA in 0.1% Tween 20/TBS for 1 h at room temperature and then incubated overnight at 4°C with antibodies specific for ARRB2 (Novus Biologicals, Centennial, CO, USA). After washing with 0.1% Tween 20 in TBS, the membranes were incubated with a 1: 3000 dilution of goat anti-rabbit IgG HRP (EMD Millipore Corp, Burlington, Massachusetts, USA) in 1% solution of powdered milk in TBS/0.1% Tween 20. The membranes were exposed to ECL solution (Bio-Rad) and imaged by chemiluminescence (Clinx Science Instrument, Shanghai, China).
Statistical analysis
Statistical analysis for expression of miRNAs and mRNAs by qRT-PCR in mouse lung tissue was performed by unpaired test. The paired t-test was performed for cell culture experiments. Probability values of P < 0. 05 were considered significant. Data analysis was performed by using the GraphPad Prism 5 software (GraphPad, San Diego, CA, USA).