Expression vectors and culturing cells
All experimental procedures were performed in accordance with the guidelines for animal experiments and human samples of the University of Tokyo as well as Keio University. cDNA expressing HA-tagged NL4X provided from Dr. Peter Scheiffele [20] was subcloned into pcDNA3.1 directional TOPO expression vector to generate a vector encoding HA-NL4-V5/His [17]. cDNAs encoding NL4X variant were generated by long PCR-based mutagenesis and analyzed by sequencer. Maintenance of COS-1 cells, HEK293 cells, IMR-32 cells, embryonic fibroblasts derived from ADAM knock-out mice of either sex [21–24] were described previously [17]. For knockdown of ADAM10 in IMR-32 cells, we used pLKO.1 puro vector (Addgene) inserted with small hairpin RNA (shRNA) against EGFP or ADAM10. pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ; http://n2t.net/addgene:8453 ; RRID:Addgene_8453) [25]. Target sequences were as follows;
shEGFP
5’-CCGGCGCTGAGTACTTCGAAATGTCTTCAAGAGAGACATTTCGAAGTACTCAGCGTTTTTG-3’
5’-AATTCAAAAAGGGACAAACTTAACAACAACATCTCTTGAATGTTGTTGTTAAGTTTGTCCC-3’
shADAM10
5-’CCGGGGGACAAACTTAACAACAACATTCAAGAGATGTTGTTGTTAAGTTTGTCCCTTTTTG-3’
5’-AATTCAAAAAGGGACAAACTTAACAACAACATCTCTTGAATGTTGTTGTTAAGTTTGTCCC-3’
Recombinant lentivirus was produced by cotransfection of pLKO.1 puro with package plasmids pCAG-kGP4.1R, pCAG-RTR2 and pCAGGS-VSVG in Lenti-X 293T cells (Takara) by polyethylenimine [26,27]. Conditioned medium was filtered through a 0.45 μm polyvinylidene difluoride filter (Millipore) and added with Lenti-X concentrator (Takara). Viral particles were centrifuged at 1500 x g for 45 min and resuspended with HBSS. After infection of recombinant virus for 24 hours, medium was changed and incubated for 24 hours. Primary cortical cultures were prepared from brains of embryonic day (E) 15-17 or postnatal day (P) 1 Balb/C mice or E17-18 Wistar rats as previously described [17,28,29]. Briefly, dissociated neurons were plated at 2.6 x 105 cells per cm2 on plates coated with poly-l-ornithine (SIGMA) and cultured in DMEM high glucose (Wako) supplemented with 50 unit/ml Penicillin, 50 mg/ml Streptomycin (Invitrogen), 0.25 μg/ml plasmocin (InvivoGen) and 10% FBS (HyClone). On the following day, the cultured medium was replaced with Neurobasal medium (Invitrogen) supplemented with 2 mM L-Glutamine, 50 unit/ml Penicillin, 50 mg/ml Streptomycin, 0.25 μg/ml plasmocin and B-27 supplement (Invitrogen). Cultures were maintained at 37°C in a 95% air/5% CO2 humidified incubator and half of the medium was changed every 3 or 4 days before use. Coculture of NL4X-expressing HEK293 cells and the primary neurons was performed as previously described [4,29].
Culture and neuronal differentiation of human induced pluripotent stem cells (iPSCs)
The healthy control human iPSC line WD39 [30] was cultured in StemFit AK02N (AJINOMOTO) on 6-well plates coated with iMatrix-511 (Nippi). Human ethics approval was obtained from the Ethics Committee in Keio University School of Medicine (Approval Number: 20080016). Cortical neuron induction of iPSCs was performed according to the prior literatures with slight modifications [31–33]. Briefly, semiconfluent iPSCs were cultured for 14 days in medium hormone mix (MHM) [34–36] with selected growth factors and inhibitors: the growth factors and inhibitors included B27 supplement (Invitrogen), 2µM SB431542 (Tocris), 1µM LDN193189 (StemRD), and 1.5µM IWP-2 (Sigma) for the first week, and B27 supplement, 150 nM LDN193189, and 1.5µM IWP-2 for the second week. The consequent neural progenitor cells were dissociated and seeded at a density of 5×104 cells/cm2 on 24-well plate coated with poly-ornithine and laminin. Terminal differentiation was induced in MHM supplemented with B27, 10 μM forskolin (Sigma), and 10 μM DAPT (Sigma) for 5 days. After day 6, the culture was maintained in neural medium (Neurobasal/B27 supplemented with 10 ng/mL BDNF, 10 ng/mL GDNF, 200 μM Ascorbic acid, 0.5 mM dbcAMP), and changed medium every 3-4 days with a half volume until day 56. For the last 3 days, the cultures were incubated with 0.1% DMSO or 10μM INCB3619 in neural medium. Here, we defined the day on which terminal differentiation was started as day 0.
Antibodies and compounds
Following antibodies were used; HA-high (3F10, Roche, x2000 dilution), α-tubulin (DM1A, SIGMA, x2000 dilution), βIII-tubulin (TUJ1, SIGMA, x5000 dilution), VGAT (#131002, Synaptic Systems, x1000 dilution), V5 tag (R960-CUS, Invitrogen, x5000 dilution) ADAM10 (ab1997, abcam, x500 dilution). For rabbit polyclonal antibody SAJ520206 was raised against synthetic peptide corresponding to NL4X cytoplasmic region (723-741) by SIGMA. For rat monoclonal antibody against extracellular region of NL4X, we injected 250 μg of the recombinant human NL4X protein (5158-NL, R&D Systems) with Freund’s adjuvant complete (SIGMA) into the foot pad of WKY/Izm rat. After three additional immunization with Freund’s adjuvant incomplete (SIGMA), iliac and inguinal lymph nodes were obtained. B cells were fused with PAI cells (JCRB0113) by polyethylene glycol (Roche) and cultured with GIT medium containing 5% FBS, Hypoxanthine/Aminopterin/Thymidine (SIGMA) and BM Condimed H1 (Roche). Screening was performed by immunocytochemical analysis using HEK293 cells stably expressing NLs. After limiting dilution and further screening, we selected clone 2C3 as human NL4X specific rat monoclonal antibody. 4PBA was purchased from SIGMA. INCB3619 was synthesized according to the patent descriptions as previously described [17].
Immunological analyses
Immunoblotting was performed as described previously [37]. Band intensities were quantified by ImageJ. Cell surface biotinylation assay using Sulfo-NHS-LC-biotin (Pierce) was performed as previously described [17]. For immunocytochemical analysis, samples were fixed by 4%PFA containing PBS and stained as previously described [38]. Briefly, fixed cells were permeabilized by 0.1% Triton X-100 and incubated with primary antibody as indicated for 2 hours. After washing by PBS, cells were incubated with secondary antibody for 30 min and mounted on slide glass. Samples were observed with a fluorescence microscope (Axio observer Z1, Zeiss, Germany) or a confocal microscope (TCS-SP5, Leica, Germany).
Quantitative immunofluorescence analysis.
Synapse formation assay was performed as described previously [29,39,40]. Dissociated cortical neuron were plated onto poly L-lysine- treated glass coverslips at a density of 130 cells / mm2. Transfected HEK293 cells were added to primary neuron at 8-10 days in vitro. After 2 days of co-culture, cells were fixed then performed immunocytochemical analysis. Synapse formation was quantified as the average fluorescence intensity of VGAT positive puncta over HA-tagged NL4X transfected HEK293 cells. Images were acquired in a blind manner to experimental condition using laser scanning microscope (TCS-SP5, Leica). Using the ImageJ software the averaged immunofluorescent signals per total area were obtained and normalized to the mean values of control experiments.
Statistical analysis
Statistical tests were indicated at each figure legends. All data are presented as mean ± SEM.