Expression vectors and culturing cells
All experimental procedures were performed in accordance with the guidelines for animal experiments and human samples of the University of Tokyo as well as Keio University. cDNA expressing HA-tagged NL4X provided from Dr. Peter Scheiffele [20] was subcloned into pcDNA3.1 directional TOPO expression vector to generate a vector encoding HA-NL4-V5/His [17]. cDNAs encoding NL4X variant were generated by long PCR-based mutagenesis and analyzed by sequencer. Maintenance of COS-1 cells, HEK293 cells, IMR32 cells, embryonic fibroblasts derived from ADAM knock-out mice of either sex [21–24] were described previously [17]. Primary cortical cultures were prepared from brains of embryonic day (E) 15-17 or postnatal day (P) 1 Balb/C mice or E17-18 Wistar rats as previously described [17,25,26]. Briefly, dissociated neurons were plated at 2.6 x 105 cells per cm2 on plates coated with poly-l-ornithine (SIGMA) and cultured in DMEM high glucose (Wako) supplemented with 50 unit/ml Penicillin, 50 mg/ml Streptomycin (Invitrogen), 0.25 μg/ml plasmocin (InvivoGen) and 10% FBS (HyClone). On the following day, the cultured medium was replaced with Neurobasal medium (Invitrogen) supplemented with 2 mM L-Glutamine, 50 unit/ml Penicillin, 50 mg/ml Streptomycin, 0.25 μg/ml plasmocin and B-27 supplement (Invitrogen). Cultures were maintained at 37°C in a 95% air/5% CO2 humidified incubator and half of the medium was changed every 3 or 4 days before use. Coculture of NL4X-expressing HEK293 cells and the primary neurons was performed as previously described [4,26].
Culture and neuronal differentiation of human induced pluripotent stem cells (iPSCs)
Human ethics approval for experiments using healthy control human iPSCs was obtained from the Ethics Committee in Keio University School of Medicine (Approval Number 20080016). The healthy control human iPSC line WD39 [27] was cultured in StemFit AK02N (AJINOMOTO) on 6-well plates coated with iMatrix-511 (Nippi). Cortical neuron induction of iPSCs was performed according to the prior literatures with slight modifications [28–30]. Briefly, semiconfluent iPSCs were cultured for 14 days in medium hormone mix (MHM) [31–33] with selected growth factors and inhibitors: the growth factors and inhibitors included B27 supplement (Invitrogen), 2 µM SB431542 (Tocris), 0.5 µM LDN193189 (StemRD), and 1.5 µM IWP-2 (Sigma) for the first week, and B27 supplement, 150 nM LDN193189, and 1.5 µM IWP-2 for the second week. For the induction of inhibitory neurons, the growth factors and inhibitors included B27 supplement (Invitrogen), 2 µM SB431542, 0.5 µM LDN193189 1.5 µM IWP-2, and 1 µM purmorphamine (Calbiochem) for the first week, and B27 supplement, 2 µM SB431542, 1.5 µM IWP-2 and 1 µM purmorphamine for the second week. The consequent neural progenitor cells were dissociated and seeded at a density of 5×104 cells/cm2 on 24-well plate coated with poly-ornithine and laminin. Terminal differentiation was induced in MHM supplemented with B27, 10 μM forskolin (Sigma), and 10 μM DAPT (Sigma) for 5 days. After day 6, the culture was maintained in neural medium (Neurobasal/B27 supplemented with 10 ng/mL BDNF, 10 ng/mL GDNF, 200 μM Ascorbic acid, 0.5 mM dbcAMP), and changed medium every 3-4 days with a half volume until day 56. For the last 3 days, the cultures were incubated with 0.1% DMSO or 10μM INCB3619 in neural medium. Here, we defined the day on which terminal differentiation was started as day 0.
Generation of NL4X knock-out iPSC-derived neural cells
Studies with human Ngn2-knock-in (KI) iPSCs were approved by the Ethics Committee on Human Tissue and Genome Research at Shionogi & Co., Ltd. (Approval Number: KS17-027, KS18-016). Feeder-free 201B7 human iPSCs [34,35] were purchased from iPS Academia Japan Inc. Ngn2 KI iPSCs were generated as described in [36]. NL4X knock-out (KO) iPSC clone was generated as follows. Briefly, an all-in-one vector which contains gRNA and Cas9 and pCXN-EGFP vector were electroporated into Ngn2-KI iPSCs using NEPA21 (Nepagene). Targeted sequence of gRNA was 5`- AAGAACACCGTTACCCAATG-3` and was designed to lower risks of off-target using CRISPR direct (https://crispr.dbcls.jp/). After 2days of electroporation, GFP+ cells were sorted by FACS aria III (BD) and cloned in 96 well plates. After expansion of cloned cells, sequences of both alleles of each clone were confirmed and a clone whose both sequences were frame-shifted was used as an NL4X KO iPSC clone.
Sequence of NLGN4X (169-195)
18WT: GGCCTAAGAACACCGTTACCCAATGAG
Mut a: GGCCTAA----------------TGAG (-16)
Mut b: GGC-------------TACCCAATGAG (-13)
Differentiation of iPSCs to neural progenitors (NPs) and neurons in adherent culture was performed as described in [37] with slight modification. Briefly, on day 0, confluent iPSCs were passaged onto Matrigel-coated dishes and cultured in AK03N medium (Ajinomoto). On day 1, doxycycline was added into the medium to induce expression of Ngn2. On day 2, an equal volume of N2 medium was added to the AK03N medium and N2 medium was used on day 3-4. On day 5, an equal amount of NB medium was added to the N2 medium and NB medium was used on day 6-8. From day 5, Cytosine arabinoside (AraC) was added to the medium to inhibit proliferation of NPs. N2 medium contains DMEM/F12, 1X N2 supplement (Invitrogen), 1X NEAA (Invitrogen), mouse laminin (0.2ug/mL), NT-3 (10ng/mL), and BDNF (10ng/mL). NB medium contains Neurobasal, 1X B-27 supplement (Invitrogen), 1X GlutaMAX-I supplement (Invitrogen), mouse laminin (0.2ug/mL), NT-3 (10ng/mL), and BDNF (10ng/mL). From day 11, BrainPhys Neuronal Medium and SM1 supplement (Stem Cell Technology) were used to promote further neural maturation.
Antibodies and compounds
Following antibodies were used; HA-high (3F10, Roche, x2000 dilution), α-tubulin (DM1A, SIGMA, x2000 dilution), βIII-tubulin (TUJ1, SIGMA, x5000 dilution), VGAT (#131002, Synaptic Systems, x1000 dilution), vGlut1 (#135303, synaptic systems, x1000 dilution), V5 tag (R960-CUS, Invitrogen, x5000 dilution) ADAM10 (ab1997, abcam, x500 dilution). For rabbit polyclonal antibody SAJ520206 was raised against synthetic peptide corresponding to NL4X cytoplasmic region (723-741) by SIGMA. For rat monoclonal antibody against extracellular region of NL4X, we injected 250 μg of the recombinant human NL4X protein (5158-NL, R&D Systems) with Freund’s adjuvant complete (SIGMA) into the foot pad of WKY/Izm rat. After three additional immunization with Freund’s adjuvant incomplete (SIGMA), iliac and inguinal lymph nodes were obtained. B cells were fused with PAI cells (JCRB0113) by polyethylene glycol (Roche) and cultured with GIT medium containing 5% FBS, Hypoxanthine/Aminopterin/Thymidine (SIGMA) and BM Condimed H1 (Roche). Screening was performed by immunocytochemical analysis using HEK293 cells stably expressing NLs. After limiting dilution and further screening, we selected clone 2C3 as human NL4X specific rat monoclonal antibody. 4PBA was purchased from SIGMA. INCB3619 was synthesized according to the patent descriptions as previously described [17].
Immunological analyses
Immunoblotting was performed as described previously [38]. Briefly, cell lysates were collected with sample buffer (2% SDS, 80 mM Tris-HCl pH6.8, 10% Glycerol, Brilliant green (WAKO), Coomassie blue G-250 (Nacalai tesque)). Protein concentrations of the samples were determined by BCA protein kit (Thermo Fisher Scientific). Then the samples were boiled at 100 degree for 3 min after addition of 1% 2-mercaptoethanol (WAKO). Same amount of proteins (typically, 10 μg/lane) were separated by SDS-PAGE, transferred onto the PVDF membrane (Millipore). After incubation of the membranes with appropriate antibodies conjugated with fluorescent dyes, bands were detected using Image Quant LAS4000 (GE Healthcare). Band intensities were quantified by ImageJ. Cell surface biotinylation assay using Sulfo-NHS-LC-biotin (Pierce) was performed as previously described [17].
For detection of soluble form of NL4X produced from IMR32 cells and iPSC neurons, the cultured medium was immunoprecipitated using 2C3 antibody. After centrifugation to remove the cell debris, the conditioned medium was incubated with rat IgG or 2C3 antibody at 4 degree for overnight on a rotator. Proteins interacted with antibodies were precipitated by protein G sepharose beads (GE Healthcare), and analyzed by immunoblotting.
Human brain sample was derived from tissue bank at the University of Pennsylvania Alzheimer’s Disease Core Center (ADCC) and the Center for Neurodegenerative Disease Research (CNDR) [39]. All samples used for experimental measures was derived from frontal cortex under approval by the institutional review board, ADCC–CNDR, and institutional ethical committee of Graduate School of Pharmaceutical Sciences, The University of Tokyo (No. 12-1). Tris buffer (TS; 50mM Tris HCl, pH 7.6,150mM NaCl, 0.5mM diisopropyl fluorophosphate, 0.5mM phenylmethylsulfonly fluoride, 1mM EGTA, 1 mg/ml antipain, 1 mg/ml leupeptin, 1 mg/ml pepstatin, 1 mg/ml Na-p-tosyl-L-lysine chloromethyl ketone) soluble and insoluble fractions from control brain were used [40]. The insoluble fraction was solubilized by TS containing 1% Triton X-100 (Tx) and analyzed after centrifugation.
Immunocytochemical analyses
Samples were fixed by 4%PFA containing PBS and stained as previously described [41]. Briefly, fixed cells were permeabilized by 0.1% Triton X-100 and incubated with primary antibody as indicated for 2 hours. After washing by PBS, cells were incubated with secondary antibody for 30 min and mounted on slide glass. Samples were observed with a fluorescence microscope (Axio observer Z1, Zeiss, Germany) or a confocal microscope (TCS-SP5, Leica, Germany).
Quantitative immunofluorescence analyses
Synapse formation assay was performed as described previously [26,42,43]. Dissociated cortical neuron were plated onto poly L-lysine- treated glass coverslips at a density of 130 cells / mm2. Transfected HEK293 cells were added to primary neuron at 8-10 days in vitro. After 2 days of co-culture, cells were fixed then performed immunocytochemical analysis. Synapse formation was quantified as the average fluorescence intensity of VGAT positive puncta over HA-tagged NL4X transfected HEK293 cells. Images were acquired in a blind manner to experimental condition using laser scanning microscope (TCS-SP5, Leica). Using the ImageJ software, the averaged immunofluorescent signals per total area were obtained and normalized to the mean values of control experiments.
Statistical analyses
Statistical tests were indicated at each figure legends. All data are presented as mean ± SEM.