5.1. Establishment of cell lines and cell culture
Construction of cell lines and culture conditions is described in the companion publication [10]. Briefly, pcDNA3.1 plasmids expressing either a wild-type PGRMC1 open reading frame with a 3x heamaglutinin (3HA) tag (WT), an S57A/S181A double mutant (DM) or an S57A/Y180F/S181A triple mutant (TM) were transfected into MIA PaCa-2 cells and stably selected by hygromycin selection. Three independent cell lines were established for each plasmid, and equivalent PGRMC1-HA expression levels for each line were established by Western blot. The exogenous PGRMC1-HA protein is present at approximately the same levels as endogenous MP cell PGRMC1. Individual cell lines have not been clonally selected, and so probably represent mixed lineages.
5.2. NpFR1 measurement of cytoplasmic redox status
Intracellular redox state measurement by fluorescent redox sensor NpFR1 was performed by flow cytometry as described for NpFR2 [10].
5.3. Genomic DNA isolation and sequencing
Genomic DNA for sequencing was isolated from one subline of each cell condition. Passaging was repeated every 4 days for thirty passages, with media changes every 48 hours. To extract genomic DNA after thirty passages, approximately 5x106 cells were centrifuged for 5 min at 300 x g. The cells were suspended in 200µL phosphate buffer saline. The purification of total DNA from cells was performed using the DNeasy Blood & Tissue Kit (Qiagen, C.N 69504) following the manufacturer’s protocol. The concentration of the dsDNA was measured using a Qubit dsDNA Hs Assay Kit (Life Technologies, Ref Q32851). The samples were sent to Kinghorn Centre for Clinical Genomics (Garvan Institute of Medical Research, 384 Victoria St, Darlinghurst, NSW 2010 Australia) for whole genomic sequencing. DNA for methylation analyses was extracted the same way except we used passage 10 cell lines, consisting of triplicate cultures of MP cells, and respective lines 1-3 of each PGRMC1-HA mutant condition (WT1, WT2, WT3, DM1, DM2, DM3, TM1, TM2, TM3).
5.4. MTT cell viability assays for effects of P4 on the dox and AG-205 responses
To assay for proliferative and protective effects of P4, 104 cells were seeded per 96 well plate well. For each cell type, n=6 replicates were allowed to adhere for 3 hours after which viable adherent cells were quantified by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay. Previous experiments had shown adherence to be complete after 1.5hr (data not shown). Identical replicates were incubated overnight in complete DMEM. After 23 hours the media was exchanged for complete DMEM containing either 1µM P4 or DMSO vehicle control. After a further 1 hour incubation (t0) the media was exchanged for media containing either 1µM P4 or DMSO vehicle control (to assay for proliferative effects, Figure 2A), or with varying concentrations of doxorubicin (dox) (Figure 2B-C) or AG-205, +/- P4 [36]. Cells were incubated for a further 24hr followed by viable cell quantification by MTT assay. The media was discarded, cells were washed with warm PBS and incubated with 100μL of 0.5 mg/mL MTT (Sigma-Aldrich M2128) in phenol red free media (Sigma-Aldrich D1145). After 3 hours incubation at 37°C and 5% CO2, the media was removed and 100μL of DMSO (EMD Millipore, 317275) was added to each well to solubilize the Formazan crystals. The cells were incubated for 1 hour followed by mixing, and absorbance was read at 570nm using a plate reader (Bio-Strategy P/L, Campbellfield, Vic., Australia). The percentage of viable cells was estimated by normalizing the absorbance of the treated or untreated cells to the average values from panel A.
5.5. NNMT shRNA attenuation
We established an anti-NNMT sh-RNA-expressing TM cell line by lentiviral transduction and puromcyin stable selection. Anti NNMT shRNA lentiviral production was as described using mission TRC2-pLKO-Puro series Lentiplasmid (SHCLND, Sigma-Aldrich) scramble shRNA (scr-sh) [10] and shRNA targeting NNMT (Sigma-Aldrich TRCN0000294436, TGCAGAAAGCCAGATTCTTAA). WT and TM cell lines expressing either scrambled shRNA (scr-WT, scr-TM) or anti NNMT shRNA (shNNMT-WT, shNNMT-TM) were seeded in 24 well plates until they reached approximately 50% confluency followed by transduction with shRNA virus particles and selection as described [10].
5.6. RT-PCR
RNA was extracted by total RNA mini kit (Bio-Rad, 7326820) according to the manufacturer’s instructions. cDNA was synthesized in C1000 Touch™ Thermal Cycler using cDNA synthesis kit (Bio-Rad, 1708890) following Bio-Rad’s recommended protocol. Real-time qPCR was performed on a CFX96 Touch™ Real-Time PCR Detection System utilizing iTaq™ Universal SYBR® Green Supermix (Bio-Rad, 1725120). NNMT Primers for qPCR were synthesized at Monash University and the sequences were obtained from [83]. NNMT primers used in this experiment were Forward sequence 5’-GAATCAGGCTTCACCTCCAA-3’ and Reverse sequence 5’-CCCAGGAGATTATGAAACACC-3’. Actin was used as an internal control Forward sequence 5’GACGACATGGAGAAAATCTG-3’ and Reverse sequence 5’ATGATCTGGGTCATCTTCTC-3’.
5.7. Western Blot
Cells were lysed with radioimmunoprecipitation assay buffer (RIPA buffer) (Sigma Aldrich, R0278) supplemented with protease and phosphatase inhibitor cocktail (Thermoscientific, 88668). After scraping the cells, they were centrifuged at 8000 rpm for 20 minutes (Hermle Centrifuge Z233 M-2) at 4°C. 20µg protein of thirty passage number of MP, WT, DM, and TM were loaded into the wells of a 12.5% SDS-PAGE gel and set to run at 150V for 45 min on Power Pac. Transferring the protein from the gel to a PVDF membrane occurred under wet transfer with 1x Towbin buffer at 40V for 3 hours in an ice bath. The membranes were incubated with 1:2000 diluted Beta-Actin (Sigma Aldrich, AS441) and 1:2000 HA-Tag (Sigma Aldrich, H3663) primary antibodies in blocking buffer overnight at 4ºC with shaking. Next day, the membranes were washed twice with 0.05% PBS-T and incubated with anti-mouse secondary antibody; horse radish peroxidase (HRP), for 1 hour at room temperature. Next, the membranes were washed twice with 0.05% PBS-T and once with PBS. Colorimetric detection of the bands occurred using tetramethylbenzidine as described [10].
5.8. Reverse phase protein array
Methods for reverse phase protein arrays are described in the accompanying publication [10]. The following primary antibodies (provider and reagent number, dilution) were used here: Erk1/2-P-Thr202/Tyr204 (CST 4370, 1:100), MEK1/2-P-Ser217/Ser221 (CST 9154, 1:100), MKK4(SEK1)-P-Ser257/Thr261 (CST 9156, 1:100), Rb (CST 9309, 1:200), Rb-P-Ser807/Ser811 (CST 8516, 1:100).
5.9. Hyperspectral fluorescence microscopy
UV and visible continuous wave epifluorescence microscopy with multiple excitation wavelength ranges from 335 nm to 532nm and measuring emission in three emission wavelength ranges 450+/- 30 nm, 587+/- 17.5 nm and 700 nm long pass were used. Excitation wavelengths are supplied by low cost multi-LED light source optical fibre coupled to the Olympus IX71 microscope. An Andor/Oxford Instruments iXon 885 Electron Multiplying Charged Coupled Device (EMCCD) was used to capture images typically using an EM gain sufficient to lift the low light auto-fluorescence signal above the 17 electrons per pixel per second readout noise but with minimal contribution from clock induced charge. Gain linearity is ensured by using the Real GainTM technology (Andor/Oxford Instruments). The camera is operated below -70°C such that thermal noise is negligible. Quantum efficiency of the sensor varies from 50-65% across the range of interest from 450-670nm and the intensity is digitized into ~16K values. Background signal is subtracted from all images which is kept minimal through the use of low fluorescence petri dishes (CELLview, Greiner Bio-One). A single wavelength image may take between 1-5 seconds depending on the sample and wavelength but 1-2 minutes is typically required for the entire stack of images for all spectral channels, , where the features for Fig. 1A were as follows.
Feature 1: 'Ratio of Channel 4 to Channel 10',
Feature 2: 'Ratio of Channel 9 to Channel 16',
Feature 3: 'Ratio Channel 2 to Channel 16',
Feature 4: 'Ratio of Channel 5 to Channel 14',
Feature 5: 'Ratio of Channel 2 to Channel 7',
Feature 6: 'Ratio of Channel 9 to Channel 18',
Feature 7: 'Ratio of Channel 7 to Channel 15',
Feature 8: 'Ratio of Channel 7 to Channel 9',
A description of the channels used and their spectral ranges is given in Table S1. During growth under standard mid-log phase growth conditions, hyperspectral imaging was performed on ~300 live cells per cell condition (MP, WT, DM, TM) and the mean cellular intensity in each channel was calculated. Pixel correlations between spectral channels were removed using principal component analysis (PCA), followed by a discriminatory projection to maximally separate the four cell groups (Fig. 1A). Technical details of this approach are described by Gosnell et al. [44]. In order to statistically analyze the cluster separations of Fig. 1A, an additional LDA projection of cell data was carried out, this time with two classes of cells chosen at a time. Their average spectra were projected onto a common direction identified by this additional LDA. The cell distributions were then tested by the Kolmogorov-Smirnov test.
5.10. Metabolite preparation
Scr-WT, scr-TM, shNNMT-WT, and shNNMT-TM cells as generated in “5.5. NNMT shRNA attenuation” above were seeded in Greiner Bio-One Tissue Culture Petri Dish 100mm x 20mm (Interpath, 664160). The cells were rinsed with pre-warmed deionised water with brief shaking. The plates were placed on liquid nitrogen for 15 seconds. Cells were extracted with 1 mL of ice-cold extraction solvent (2:2:1methanol-ethanol-water) and harvested with scraper. The contents were transferred to 1.5 mL Eppendorf tube. The tubes were centrifuged at 4°C for 5 minutes at 16,100 x g and supernatant were transferred to a new 1.5 mL Eppendorf tube. The supernatant was filtered and evaporated dry under a gentle stream of nitrogen gas. The residual precipitates were resuspended in 500 µL of 60% acetonitrile/water (ACN/H2O) containing m-tyrosine (10 µg/mL) (Sigma, Castle Hill, NSW) as an internal standard.
5.11. Metabolite quantification
Metabolomic analysis was performed using an Agilent 1290 Infinity HPLC system equipped with a quaternary pump, degasser, temperature-controlled column and sample compartment coupled to an Agilent 6470 triple quadrupole (QQQ) mass spectrometer with a Double Jet Stream electrospray ionization (ESI) source (Agilent Technologies, Australia).
The column temperature was maintained at 35°C and the autosampler temperature was set at 4 °C. The electrospray (ESI) source settings were as follows: nebulizer gas, 45 psig; drying gas flow rate, 8.0 L/min; drying gas temperature, 300°C; sheath gas temperature, 350°C, sheath gas flow, 10 L/min; capillary voltage, 4000 V; and nozzle voltage, 0 V. The data were acquired positive ionization mode.
Methylnicotinamide samples and samples from Fig. 6A were analyzed with a Kinetex HILIC column (50 mm × 2.1 mm, 2.6 μm particle size, pore size of 100 Å, Phenomenex, CA, USA). The mobile phases were 100% HPLC-grade acetonitrile (A) and 10 mM ammonium acetate in HPLC-grade water adjusted to pH 3 with formic acid (B) at a flow rate of 200 μL/min. The solvent gradient began with 95% ACN for 0.5 minutes, decreasing linearly to 35% ACN over 12 minutes. The gradient was maintained at 35 % ACN for 0.5 minutes and increased to 95 % ACN over 0.1 minutes. The mobile phase composition was then held at 95% CAN for 10 minutes to re-equilibrate the column before the next injection. The total time for the gradient program was 24 minutes.
1-MNA was tentatively identified with m/z of 137.0633 Da, and an MS/MS score of 99.74. Samples of authentic 1-methylnicotinamide chloride (1-MNA) (CAS Number 1005-24-9, Sigma-Aldrich # M4627), 2-methylnicotinamide (2-MNA) (CAS Number 58539-65-4, Ark Pharm Arlington Heights, IL 60004 , USA, #AK-39636) and N-methylnicotinamide (N-MNA) (CAS Number 114-33-0, Sigma-Aldrich #M4502) were injected at three concentrations (1, 10 and 100 µg /mL) to confirm identification of 1-MNA. The compound was unambiguously identified as 1-MNA with retention time (RT) of 7.33 min and m/z of 137.0717, and not 2-MNA (RT 0.96 min, m/z 137.0719) or N-MNA (RT 0.97 min, m/z 137.0709). The response of the triple quadrupole mass spectrometer to 1-MNA was linear over the range of 10 ng/mL to 1 µg/mL, and the identity was confirmed by MS/MS and HPLC retention time using 2-methylnicotinamide and N-methylnicotinamide standards (not shown).
Cellular extracts except Fig. 6A were analyzed with a HILIC-Z column (50 mm × 2.1 mm, 2.6 µm particle size, 100 Å pore size, Agilent Technologies, CA, USA) equipped with a guard column of the same stationary phase. The mobile phases were HPLC-grade acetonitrile:water (95:5) (A) and water (B), both containing 20 mM ammonium formate and 0.1% formic acid (pH ~3) at a flow rate of 400 µL/min. The solvent gradient started at 100% A and was held for 0.5 minutes, followed by a linear gradient from 100% A to 60% A over 9 minutes. The gradient was maintained at 60% A for 0.5 minutes and returned to 100% A over 0.1 minute. The solvent was then held at 100% A for 5.4 minutes to re-equilibrate the column before the next injection. Injection volume was 2 µL. The total time for the gradient program was 15 minutes.
Analysis of the set of samples was preceded and followed by injection of five concentrations of 1-MNA (10 µg/mL to 1 ng/mL in log steps) and six concentrations of S-adenosyl methionine (SAM) (100 µg/mL to 1 ng/mL) (Sigma-Aldrich, Castle Hill, NSW). In addition, after every 15 samples a blank injection and a mixture of 1-MNA, m-tyrosine and SAM was run to verify that there was no carryover between samples and that retention time and detector sensitivity had not changed during the course of running the samples.
The selective detection and quantitation of 1-MNA was achieved by monitoring the transition of m/z 137 → 108 using a fragmentor voltage of 120 V and collision energy of 20 V, with the further requirement that retention time matched that of the authentic compound (ca. 2.7 min). m-tyrosine was quantitated by monitoring the transition m/z 182 –> 136 (fragmentor voltage 135 V, collision energy 20 V, RT = 4.9 min) and SAM was quantitated by monitoring the transition m/z 399 -> 136 (fragmentor voltage 100 V, collision energy 20 V, RT = 9.1 min). The fragmentor voltage and collision energy values were determined by optimizing system response to authentic 1-MNA, m-tyrosine and SAM. Limits of quantitation were determined by regressing the log(detector response) to log(concentration) response over the range of serial dilutions for each standard, and by observing where the dose/response curve departed from linearity.
5.12. Effect of 1-MNA on morphology
MiaPaCa-2 cells expressing DM PGRMC1-HA were seeded at 25% confluency and cultured overnight. The media was removed and the cells were incubated in the presence of the indicated amount of 1-MNA (Sigma-Aldrich, Castle Hill, NSW) for 24 hours. The 1-MNA stock was made in sterile H2O. Five random images were taken per treated culture and assigned random numbers 1-20. These were given to a blinded scorer who decided for each image whether given cells were round or elongated.
5.13. Methylome Assay
Genomic DNA from each cell subline were processed using the Illumina Infinium HD Methylation Assay (EPIC array) which interrogates >850,000 CpG sites. The four cell lines were processed in triplicate equating to 12 samples, being three replicates of MP cells, and independent cell lines 1-3 for each of the PGRMC1 states [10]. The array was prepared at the Australian Genome Research Facility (AGRF) following the manufacturer’s instructions. Quality checking of the samples was performed by Nanodrop Spectrophotometer and resolution on a 0.8% agarose gel at 130 V for 60 minutes. 500ng total DNA was bisulfite converted with Zymo EZ DNA Methylation kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s standard protocol. Amplified DNA samples were fragmented and resuspended DNA was loaded onto a BeadChip. The BeadChip was incubated overnight while DNA fragments anneal. After hybridization the array was imaged on the Illumina iScan system.
Methylation data were processed using in R version 3.5.1 (www.r-project.org). Data were assessed using the hg19 build of the human referene genome annotated in the IlluminaHumanMethylationEPICanno.ilm10b4.hg19 bioconductor annotation. Quality control of the array was assessed with the R package Lumi [84]. Probes on the sex chromosomes, cross-reactive probes and probes with known SNPs at the CpG site were excluded. Following filtering 812,817 probes remained. The cleaned data were normalized with the SWAN normalization, and sample relationships examined. Genome-wide differential methylation analysis was undertaken using Limma [85]. Multiple testing correction was applied using the Benjamini and Hochberg method. Differential methylation in each group was observed on volcano plots and heatmaps.
Due to the excessive quantity of differentially methylated probes with small effects we refined the data used for functional analysis to the top 2000 most variable probes prior to pathways analysis. These probes explained >90% of the total variance among the first two principle components while preserving a reasonable number of intragenic probes. Pathways enrichment was undertaken in R using the enrichPathway function in the ReactomePA package [86], which implements a one-tailed hypergeometric test for overrepresentation. Multiple testing adjustment was applied with the Bonferroni & Hochberg FDR. KEGG pathways analysis was undertaken using the kegga function in the R package in LIMMA. Enrichment was calculated for genes from the top 2000 most variable probes with a p-value <0.05. The gene sets were split to those with hypomethylated probes (logFC<0) and those with hypermethylated probes (logFC>0) for enrichment. Enrichment of Gene Ontology (GO) terms was undertaken using the GOstats package [87]. Ontology assignments are calculated using a hypergeometric test for overrepresentation on the significantly differentially methylated probes (p<0.05) among the 2000 most variable. Multiple testing adjustments were applied using the FDR. Intersects of common pathways from KEGG and Reactome analyses were assessed using the UpSetR package [88].