Tissue sampling
A total of 45 surgical specimens of colorectal carcinomas (CRCs) and adjacent normal mucosa were obtained between February 2016 and February 2018 at National Cancer Center Hospital. All experimental methods were carried out in accordance with relevant guidelines and regulations. The use of patients’ surgical specimens in this study was approved by the ethics committee of the National Cancer Center, Tokyo, Japan (2015-108), and written informed consent was obtained from all patients. After sampling for pathological evaluation, they were stored on ice, and each sample was dissected into approximately 2-5-mm cubes and used for culture of organoids and fibroblasts. Remaining fragments were simultaneously frozen in liquid nitrogen and stored at −80˚C for isolation of DNA and RNA, or fixed with 10% buffered formalin for preparation of tissue sections for morphological identification of the organoid- and fibroblast-originated tumor tissues. The fragments for RNA isolation were stored in RNAlater solution (ThermoFisher Scientific, Tokyo, Japan) at 4°C overnight before storage.
Organoid culture
The protocol employed for organoid culture was a modified version of those previously reported 48, 49. The fragments of CRC tissues were washed with cold HBSS(-), minced with scissors, and washed again. These fragments were incubated in Accumax (Innovative Cell Technologies, San Diego, CA, USA) at room temperature or TrypLE Express (ThermoFisher Scientific, Tokyo, Japan) at 37°C for 30 min with shaking. The digested fragments were rinsed with cold HBSS(-), dissociated using a 100-μm cell strainer, and pelleted. Advanced DMEM/F12 (ThermoFisher Scientific) supplemented with 1 x penicillin-streptomycin, 500 ng/ml of Amphotericin B (FUJIFILM Wako, Osaka, Japan), 1 x Zell Shield (Minelva Biolabs GmbH, Berlin, Germany), 10 mM HEPES (ThermoFisher Scientific), 1 x L-glutamine (FUJIFILM Wako), [Leu15]-GastrinI (Sigma-Aldrich, Tokyo, Japan), 1 mM N-acetyl-L-cysteine (FUJIFILM Wako), 1 x B27 supplement (ThermoFisher Scientific), 1% BSA (FUJIFILM Wako), and 10 μM Y27632 (FUJIFILM Wako) was used as the basal culture medium for CRC organoids. The pellet was suspended in the basal culture medium containing the following factors: 50 ng/ml of Recombinant Human EGF (Peprotech, Rocky Hill, NJ, USA), 100 ng/ml of Noggin (Peprotech), and 500 nM A83-01 (FUJIFILM Wako).
In a 12-well plate, 65 μl of Matrigel (Corning, Bedford, MA, USA) /well was polymerized for 15 min at 37°C and a 650-μl cell suspension /well x 3 was seeded and incubated in a 37°C humidified CO2 incubator. After 24 hours, the supernatants were removed and 85 μl/well of Matrigel was overlaid. After Matrigel polymerization, the basal culture media containing different factor combinations [A:250 ng/ml of R-spondin 1 (Peprotech) + 20 ng/ml of Wnt-3a (Peprotech) +25 μM SB202190, B: 25 μM SB202190, and C: none] was used to select the most efficient growth media during several passages. The organoids were dispersed by Accumax and passaged approximately once a week. Zell Shield was not used after several passages. When organoids with more than 10 passages (P10) survived after a freeze and thaw cycle, they were defined as “successfully established”.
Fibroblast culture
Two to three tissue fragments were washed three times with HBSS(-), placed in a 60-mm dish, and minced with scissors. Then, culture medium, RPMI-1640, containing L-Glutamine (FUJIFILM Wako) and 10% FBS, penicillin-streptomycin was added into the dish and cells were incubated at 37°C in a humidified 5% CO2 incubator. After they reached 70% confluency, cells were passaged using TrypLE Express dissociation reagent (ThermoFisher Scientific).
Co-culture of organoids with fibroblasts using a chamber system
Organoids were cultured in the cell culture inserts with a porous membrane and fibroblasts were cultured in the carrier plates (Corning). The pore size of the insert was 1.0 μm to allow the free exchange of media but not cells to migrate through. One day before starting the co-culture, fibroblasts were dissociated into single cells using TrypLE Express and 1 x 104 cells were cultured in a 24-well plate with RPMI-1640 containing penicillin-streptomycin, Amphotericin B, and 10% FBS. For organoid culture, cell culture inserts were set on the 24-well companion plate and 20 μl of Matrigel was polymerized on the insert. Organoids were dissociated by Accumax and resuspended in optimized media for organoids described above. The cell suspension (1 x 104 cells / 200 μl) was seeded onto the Matrigel and 620 μl of media for organoids was added to the basal compartment. Fibroblasts and organoids were incubated at 37°C in a CO2 incubator.
The next day, apical and basal media were removed from the plate containing organoids attached on the Matrigel, and organoids were covered with 20 μl of Matrigel and polymerized at 37°C for 15 min. The inserts containing organoids were transferred to the fibroblast-containing compartment plate after changing the medium from that for fibroblasts to 820 μl of optimized media for organoids. The co-culture plate was incubated at 37°C in a CO2 incubator for 96 hours, and organoids and fibroblasts were collected separately for gene expression analysis.
Targeted sequencing analysis
Genomic DNA from 45 samples of CRC and organoids of cases #11, #21, #25, #28, #32, #33, and #44 were prepared using NucleoSpin Tissue kit (Takara Bio, Kusatsu, Japan) according to the manufacturer’s protocol. Targeted sequencing analyses of those DNAs were performed using the NCC Oncopanel v4 test, which can analyze mutations of 114 genes and amplifications and fusions of 12 genes 50. Procedures for targeted sequencing and data analysis were previously described 50.
TP53 mutations identified by the NCC Oncopanel test were confirmed by Sanger sequencing. The PCR products including mutations were amplified using specific PCR primers. Primers used for A578G and G589A mutations of #21 and #32, respectively, were forward: 5’-GGAGGTCAAATAAGCAGCAGG-3’ and reverse: 5’-GGCCTCTGATTCCTCACTGA-3’. Primers used for a 45_48TCAG deletion of #28 were forward: 5’-CCCAACCCTTGTCCTTACCA-3’ and reverse: 5’-CAGTCAGATCCTAGCGTCGA-3’. The amplified PCR products were directly sequenced by Sanger sequencing using the following primers. The primer for #21 and #32 was 5’-ACAACCACCCTTAACCCCTC-3’. The primer for #28 was 5’- CCCAACCCTTGTCCTTACCA -3’
Gene expression analysis using DNA microarray
Total RNA was extracted from original tumor tissues and established organoids of cases #11, #25, #28, #32, and #44 using NucleoSpin RNA Plus (TaKaRa) according to the manufacturer’s protocol. Total RNA was extracted from three replicates of co-cultured organoids and fibroblasts for #21, #28, and #32 using the RNeasy Micro kit (QIAGEN, Tokyo, Japan). The quality of the RNA samples was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and highly qualified RNA samples with a RIN score > 7.0 were selected for further DNA microarray analysis. Triplicate samples were used as an RNA cocktail. Cy3-labeled cRNA was hybridized on SurePrint G3 Human GE Microarray GE 8 x 60K Ver.3.0 (Agilent Technologies) according to the manufacturer’s instructions. The Subio Platform, Subio Basic plug-in, and Subio Advanced plug-in (ver 1.24) (Subio, Kagoshima, Japan) were used for data analysis.
Quantitative real-time PCR
One µg of total RNA for each sample was treated with DNase I (NIPPON GENE, Tokyo, Japan) prior to reverse transcription to cDNA using Multiscribe Reverse Transcriptase with random primers (ThermoFisher Scientific). qRT-PCR was performed with SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, California, USA) using DNA Engine Opticon 2 (MJ Research, Quebec, Canada). Reactions were run in triplicate in three independent experiments. Data were normalized with the housekeeping gene b-ACTIN and were calculated by the 2 -ΔΔCT method 51. Data were presented as means ± SD (1.0-fold as the control). The primer sequences were as follows: b -ACTIN forward 5’- AAACTGGAACGGTGAAGGTG-3’ and reverse AGAGAAGTGGGGTGGCTTTT3’, ACTA2 forward 5’-CTGTTCCAGCCATCCTTCAT-3’ and reverse 5’-GCTGGAAGGTGGACAGAGAG-3’, REG1A forward 5’ CTGGAATCCTGTGCTTGAGG-3’ and reverse 5’-GGTCTCCTACAAGTCCTGGG-3’, REG3A forward 5’-CCTCTGGAAACCTGGTGTCT3’ and reverse 5’-CCACTCCCAACCTTCTCCAT3’, DUOX2 forward 5’- GAGCCCTTCTTCAACTCCCT-3’ and reverse 5’-GGAGGACAGGCTCAGAAGTT-3’, and DUOXA2 forward 5’-GGTCTCCTACAAGTCCTGGG-3’ and reverse 5’-TTTACAGATCGCCCCAGGAG-3’.
Cell viabilityThe viability of organoids was assessed after co-culture with fibroblasts for 96 hours using the chamber system. After aspirating culture medium, 100 μl of fresh culture medium was added. Then, Matrigel including organoids was scraped using a mini cell scraper, 100 μl of CellTiter-Glo 3D reagent was added (Promega, Tokyo, Japan), and organoids were disrupted by pipetting. Suspensions were transferred to 96-well assay plates and incubated at room temperature for 25 min. After incubation, the luminescence was measured using Synergy H1 (BioTek, Tokyo, Japan).
Gene Ontology (GO) enrichment analysis
To clarify the biological meaning of the key modules, the gene information was loaded into Metascape (http://metascape.org) for Gene Ontology (GO) enrichment analysis 52. Terms with a P-value <0.01, a minimum count of 3, and an enrichment factor >1.5 were collected and grouped into clusters based on their membership similarities (Kappa scores >0.3).
Statistical analysis
The associations between clinical factors and the establishment of organoids were tested using Fisher’s exact test in EZR 53. For qRT-PCR and cell viability assay, results were presented as the mean ± s.d. Differences between groups were analyzed by the Student’s- t- test or one-way ANOVA using EZR. P-values of < 0.05 were considered significant.