Revealing Genetic Diversity, Population Structure and Cultivar-Specific SSR Alleles in Pistachio Using SSR Markers

doi:10.21203/rs.3.rs-1104578/v1

Download PDF

Research Article

Revealing Genetic Diversity, Population Structure and Cultivar-Specific SSR Alleles in Pistachio Using SSR Markers

https://doi.org/10.21203/rs.3.rs-1104578/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Pistachio (Pistacia vera L.) is the only cultivated species in Pistacia genus and one of the most important nut crop in terms of production. Pistachio cultivars have significant level of variation in their phenotypic appearance and productivity. Understanding the genetic diversity between pistachio cultivars could facilitate breeding programs. Simple sequence repeat (SSR) markers are powerful tools in genetic diversity and germplasm collection studies. However, published information about the characterization of large scale pistachio cultivar germplasm with adequate number of SSR markers is limited. In this study, sixty-six pistachio cultivars and genotypes originated from six different countries were characterized and fingerprinted by 74 genomic and 18 genic SSR markers. SSR analysis identified 576 alleles for all 66 cultivars and genotypes. The number of alleles per locus ranged from 2 to 20 (CUPOhBa1592) alleles with a mean value of six alleles per locus. The polymorphism information content (PIC) values ranged from 0.07 (CUPVEST2939) to 0.87 (CUPSiOh2460) with a mean PIC value of 0.58. The pistachio cultivars and genotypes were divided into five clusters according to Structure and UPGMA (Unweighted Pair Group Method with Arithmetic Average) analysis. Total of 61 cultivar specific alleles were detected in 34 cultivars, among them three primers (CUPOhBa1592, CUPBaPa1606 and CUPOhBa2127) produced more than four cultivar-specific loci therefore very promising for cultivar identification, fingerprinting and breeding studies in pistachio.

Agronomy

General Biochemistry

Molecular Biology

Pistachio

Pistacia vera

SSR

cultivar-specific

Pistachio (Pistacia vera L.) belongs to the genus Pistacia which is a member of Anacardiaceae family. The genus Pistacia has at least 11 species (Zohary, 1952; Kafkas, 2006a) and pistachio is the only species with economic importance. P. vera is a wind-pollinated and dioecious species with some exceptions (Kafkas et al. 2000). Pistachio is a diploid plant with a haploid chromosome number of n=15 (Kafkas, 2019). Pistachio has originated in central Asia, later spread from its origin to Mediterranean region of Southern Europe, Middle east, North Africa, China, United States and Australia (Kafkas, 2006b). Pistachio is cultivated between 30°-45° at south-north parallels, which are considered as microclimate regions generally in the northern hemisphere (Tunalioglu and Taskaya, 2003). Pistachio is a good source of proteins, dietary fibers, vitamins, minerals, and antioxidants (Kashaninejad and Tabil, 2011). Total world production of pistachio has reached to 1.375,770 metric tons in 2018, and Iran, USA, and Turkey are the main pistachio producer countries (Faostat, 2020).

Phenological and morphological characters are seriously affected by environmental conditions, and plants must have reached a certain stage of growth in order to evaluate such characteristics. While molecular markers can efficiently detect polymorphism at the DNA level at a very early stage of plant development. Therefore, molecular characterizations were preferred by many researchers in characterization of plants. Until now, different molecular marker systems have been improved and utilized in genetic characterization and mapping, marker-assisted breeding, etc. (Guney et al. 2018; Karcı et al. 2020). Among PCR-based techniques, simple sequence repeat (SSR) is preferred due to its advantages of being codominant inheritance, abundance in the genome, high polymorphism, high repeatability and transferability between closely related species (Zaloglu et al. 2015; Kafkas, 2019). SSR markers have been preferred in genetic characterization studies in different species such as apricot (Hormaza, 2002), apple (Potts et al. 2012), pear (Fan et al. 2013), walnut (Topcu et al. 2015), pistachio (Zaloglu et al. 2015) and quince (Guney et al. 2019). Accurate evaluation of genetic relationships between cultivars is essential in pistachio breeding programs. Kafkas (2019) reported that the use of SSR markers for determination of the relationship among pistachio cultivars is an extremely reliable approach and molecular markers plays an important role in overcoming many obstacles in pistachio breeding programs.

There are many genetic characterization studies based on different molecular markers such as RAPD, AFLP, ISSR, and SSR in pistachio (Hormaza et al. 1994; Kafkas et al. 2006; Kolahi-Zonoozi et al. 2014; Zaloglu et al. 2015; Motalebipour et al. 2016; Karcı et al. 2020). Molecular characterization studies of pistachio cultivars were firstly carried out using RAPD technique (Hormaza et al. 1994; Dollo et al. 1995; Caruso et al 1998). Then, Kafkas et al. (2006) detected the relationship of pistachio cultivars using AFLP, ISSR, and RAPD markers. However, characterization studies using comprehensive sets of SSR markers in large scale pistachio cultivars are limited. Recently, Khadavi et al. (2018) performed genetic characterization of pistachio cultivars originated only from Iran using SSR markers developed by Topçu et al. (2016).

In this study, a wide pistachio germplasm originated from Turkey, Iran, Syria, Tunisia, Greece and Italy were used for genetic diversities and relationships analysis. Additionally, cultivar-specific SSR markers were mined from wide scale pistachio cultivars and genotypes with different origins for the first time.

Plant material and DNA extraction

Sixty-six pistachio cultivar and genotypes originated from six countries were used in this study. The pistachio germplasm was located at the Research and Experimental area of the Pistachio Research Institute in Gaziantep province of Turkey (Table 1).

Total genomic DNA was isolated from fresh young leaves by the CTAB method described by Doyle and Doyle (1987) with some modifications (Kafkas et al. 2006). Qubit Fluorometer (Invitrogen) was used to quantify the isolated DNAs, followed by diluting them to 10 ng/µl for SSR-PCR reactions, and then the samples were stored at -20 °C for further analysis.

SSR-PCR reactions

One-hundred genomic SSR primer pairs developed by Khodaeiaminjan et al. (2018) and 26 genic SSRs developed by Zhaanbaev (2018) in pistachio were screened for amplification and polymorphism in eight pistachio cultivars. Finally, a total of 92 set of polymorphic SSR primer pairs (74 genomic and 18 genic SSRs) were selected for the characterization of 66 pistachio cultivar and genotypes (Table 2, Supplementary Table 1).

All SSR-PCR reactions were done based on a three primer strategy according to Scheulke (2000) with minor modifications. A total volume of 12.5 µl containing 10 ng DNA, 20 mM (NH₄)₂SO₄, 75 mM Tris–HCl (pH 8.8), 0.01% Tween 20, 2.0 mM MgCl₂, 200 µM of each dNTP, 10 nM M13 tailed forward primer at the 5′ end, 200 nM reverse primer, 200 nM universal M13 tail primer (5′-TGTAAAACGACGGCCAGT-3′) labeled with FAM, VIC, NED or PET dye, and 0.6 U of Taq DNA polymerase were used for each reaction. PCR amplifications were done in two consecutive steps. The first step included initial denaturation at 94°C for 3 min, followed by 28 cycles of 94°C for 30 s, 58°C for 45 s, and 72°C for 60 s. The second step involved 10 cycles of 94°C for 30 s, 52°C for 45 s and 72°C for 60 s, and a final extension at 72°C for 5 min. When the PCRs were completed, the reactions were subjected to denaturation for capillary electrophoresis in an ABI 3130xl genetic analyzer [Applied Biosystems Inc., Foster City, CA, USA (ABI)] using a 36-cm capillary array with POP7 as the matrix (ABI). Then samples were denatured by mixing 1.0 µl (in 6-FAM and VIC labeled primers) or 1.5 µl (in NED and PET labeled primers) of the amplified product, 0.3 µl of the size standard and 9.7 µl of Hi-Di formamide. The ABI data collection software 3.0 was used for resolving the fragments, and then SSR fragment analysis was done using the GeneMapper 4.0 (Applied Biosystems Inc.).

Data analysis

After capillary electrophoresis of the SSR loci, effective number of alleles (Ne), expected heterozygosity (He), the number of alleles per locus (Na), and observed heterozygosity (Ho) were calculated using the GenAlEx version 6.5 program (Peakall and Smouse, 2012). Polymorphism information contents (PIC) for the SSR loci were calculated using PowerMarker software version 3.25 (Liu and Muse, 2005).

The UPGMA (Unweighted Pair Group Method with Arithmetic Average) based dendrogram analysis was conducted in MEGAX software (Kumar et al. 2018). Population structure and identification of admixed individuals was performed using the model-based software program, STRUCTURE 2.3.4 (Pritchard et al. 2000). In this model, a number of populations (K) are considered to be available, which each of them is characterized by a set of allele frequencies at each locus. Individuals in the sample are given to populations (clusters), or jointly to more populations if their cultivars indicate that they are admixed. Ln P (D) values (logarithm probability for each K) were applied to determine the Delta K indicating the probable population number. The term of Delta K is calculated by the change ratio of logarithm probability (ΔK=2 to ΔK=10). In the diagram, the highest K of Delta K confers the information about the probable population number. Besides, Principal Coordinates (PCoA) based clustering was also done using the subroutine EIGEN. (PCoA) was constructed with the MEGAX (Kumar et al. 2018).

Polymorphism levels of SSR loci

A total of 92 SSR primer pairs generated scorable and polymorphic bands and they were consequently applied for fingerprinting of 66 pistachio cultivars and genotypes (Table 3). In total, 576 alleles were detected for all studied cultivars, and the number of alleles varied between 2 to 20 alleles per locus (Table 3) with a mean value of 6.0. The highest number of allele was obtained from the CUPOhBa1592 locus (Na=20). The number of effective alleles (Ne) ranged from 1.08 (CUPVEST2939) to 8.12 (CUPOhBa1592) with an average of 3.14. The observed heterozygosity (Ho) changed from 0.00 to 1.00 with a mean of 0.58. Observed heterozygosity (He) was highest in the CUPOhBa1592 loci. The average value of expected heterozygosity (He) was 0.63 and the highest value (0.88) was obtained from CUPOhBa1592 locus. Polymorphism information content (PIC) of the loci ranged from 0.07 (CUPVEST2939) to 0.87 (CUPSiOh2460) with an average of 0.58 (Table 3).

Cultivar specific SSR alleles

A total of 43 primer pairs produced 61 cultivar specific alleles belonging to 34 cultivars, and the allele frequencies ranged from 0.008 to 0.012. The highest number of cultivar specific loci was obtained from CUPOhBa1592, CUPBaPa1606, and CUPOhBa2127 with 6, 4, and 4 cultivars, respectively. Remained 40 primer pairs produced cultivar specific alleles for only one or two cultivars or genotypes (Supplementary Table 3).

Genetic relationships among pistachio cultivars

Cluster analysis was performed for 66 cultivars and genotypes using 92 SSR primers that amplified in all tested genotypes. Pistachio cultivars and genotypes were grouped into five clusters by the UPGMA analysis (Fig. 1). Genetic dissimilarity coefficients ranged from 0.01 to 0.79. The furthest of genetic distance according to 0.79 was detected between M7 and Male-13, M7 and Male-22, M3 and Male-13 in 66 cultivars and genotypes. Selection-4 and Selection-5 were the closest genotypes with 0.01 genetic distance obtained from UPGMA analysis in all pistachio cultivars. Cluster-I can be defined as Iranian cultivars and related genotypes. The highest genetic dissimilarity coefficient (0.04) in the Cluster-I was obtained between Bilgen and Haciserifi pistachio cultivars. The lowest genetic dissimilarity coefficient (0.65) was obtained between Peters and Bilgen cultivars. Cluster-II consisted of Siirt and other cultivar and genotypes that closer to it. In the Cluster-II, the closest relationship (0.01) was between Selection-4 and Selection-5 cultivars and the furthest genetic distance (0.64) was between Sivri and 25-90 genotypes. Cluster-III included to Turkish and Syrian cultivars. The Cluster-III was divided into two sub-clusters: the first sub-cluster included cultivars between Selection-7 and 23-102 cultivars, while the second sub-cluster contained cultivars from Selection-13 to M3 cultivar. Sfax cultivar was not in sub-clusters but was grouped in the cluster-III. The lowest genetic dissimilarity coefficient (0.59) was obtained between Sfax and 23-102 cultivars. Turkish male cultivars Kaska, Bagyolu, Atli, and Uygur were placed in Cluster-IV. In the Cluster-IV, the highest genetic dissimilarity coefficient (0.02) was calculated between Uygur and Atli cultivars. The furthest genetic relationship (0.56) was obtained between cv. Kaska and 1-76 genotype. Male-13 and Male-22 were the closest genotypes with the genetic dissimilarity coefficient of 0.07 in the Cluster-V (Fig. 1, Supplementary Table 2).

Structure analysis was performed in 66 pistachio cultivars and genotypes using 92 amplified SSR loci by STRUCTURE and STRUCTURE HARVESTER programs. The highest value of Delta K (ΔK) was obtained at ΔK=5 (Fig. 2). ΔK=5 corresponded to the most possible number of populations in the study. Thus, all cultivars categorized into five major clusters similar to UPGMA analysis results (Fig. 1). The dendrogram of the relationships of cultivars was very similar to structural genetic analysis (Fig. 1 and Fig. 3).

Principal Coordinate Analysis (PCoA) was done to envision the relationship among the cultivars in detail. The PCoA results indicated that the first three principal components accounted for 72.17 % of the all variations. The results of the PCoA showed that all cultivars are evidently separated from each other (Fig. 4). Overall patterns of genetic differentiation examined using the UPGMA and the Structure analysis (Fig. 1 and 3) and PCoA were in accordance with each other. The overall PCoA based on genetic dissimilarity matrices were applied to envision the genetic relationships among pistachio cultivars (Fig. 4). The first principal component accounts for 16.77% of the total variance. The cultivars that correlate the most with the first principal component (PC1) having eigenvalues greater than 1 are 18 cultivars of 66 with the average of 1.55 eigenvectors. The first principal component is positively correlated with all eighteen of these cultivars. However, Iranian cultivars in PC1 showed highest dissimilarity with each other with high eigenvectors. Our results proved that there is a high level of genetic diversity in the pistachio cultivars studied in this paper.

SSR polymorphism

Several studies about the genetic diversity and relationships of pistachio and wild Pistacia genotypes were performed using SSR markers (Vendramin et al. 2009; Baghizadeh et al. 2010; Pazouki et al. 2010; Arabnezhad et al. 2011; Kolahi-Zonoozi et al. 2014; Zaloglu et al. 2015; Motalebipour et al. 2016; Khodaeiaminjan et al. 2018). However, these studies are limited due to the low number of P. vera cultivars or SSR markers. The first development SSR study was reported using several pistachio cultivars by Ahmad et al. (2003, 2005). However, because there is no sufficient SSR markers for identification of genetic relationship and diversity, Kafkas et al. (2006) studied polymorphism of a wide germplasm of pistachio and comparison of different molecular markers such as AFLF, ISSR and RAPD. Recently, genetic characterization of the domestic Iranian pistachio cultivars was performed using SSR markers (Khadivi et al. 2018). To date, there is no genetic diversity study available with adequate number of SSR markers in large scale of pistachio cultivars with different origin.

The average allele value detected from previous studies were 3.30 (Ahmad et al. 2003), 2.90 (Ahmad et al. 2005), 2.75 (Baghizadeh et al. 2010), 1.96 (Pazouki et al. 2010), 2.80 (Arabnezhad et al. 2011), 2.75 (Kolahi-Zonoozi et al. 2014), 3.60 (Zaloglu et al. 2015), 4.50 (Motalebipour et al. 2016), 4.2 (Khodaeiaminjan et al. 2018), 2.73 (Karcı et al. 2020). In the present study, 576 alleles with an average of 6.26 alleles per locus derived from 92 SSR loci were detected. The reasons of the lower number of mean alleles in previous findings are insufficient number of markers, low number of cultivars and limited genetic variation within individuals. SSR loci derived from the coding and non-coding regions can be beneficial in molecular fingerprinting of P. vera L. if a study has high genetic diversities among accessions (Topçu et al. 2015; Khodaieminjan et al. 2018; Karcı et al. 2020).

In the current study, average PIC values were between 0.07 and 0.87 with an average of 0.58. The average PIC value in this study was higher than 0.33 and 0.44, respectively (Kolahi-Zonoozi et al. 2014; Baghizadeh et al. 2010), while it was lower than 0.64 (Khadivi et al. 2018). In the present study, average He and Ho values were 0.63 and 0.58, respectively. while Khadivi et al. (2018) reported them as 0.22 and 0.44, Kolahi-Zonoozi et al. (2014) reported as 0.35 and 0.49. Average values of Ho and He and PIC were 0.53, 0.56, and 0.51, respectively, in 18 P. vera cultivars (Khodaeiaminjan et al. 2018). The similar situation was observed a total of 51 EST-SSR loci developed from pistachio cv. Siirt and they generated He=0.40, Ho=0.38 and PIC=0.34 (Karcı et al. 2020). On the other hand, average Ho value was identified from 18 SSR loci as 0.64 by Arabnezhad et al. (2011) while average Ho value was calculated from four SSRs as 0.52 by Baghizadeh et al. (2010). In addition, He values were 0.45 and 0.75, respectively (Arabnezhad et al. 2011; Baghizadeh et al. (2010). As a result, polymorphism information content and observed and expected heterozygosities demonstrated variability due to using more or less polymorphic SSR loci and also higher or less narrow genetic diversity rate in the population.

Identification of cultivars using SSR markers is very efficient tool to select in early phase in different breeding programs (Ashkenazi et al. 2001). Some markers in this study can identify most important commercial cultivars. For example: Kerman (USA) and Siirt are the most cultivated female varieties in United States and Turkey can be identified by CUPBaPa1606 and CUPOhBa2127, respectively; while Peter and Kaska are the most cultivated male varieties can be identified by CUPOhBa1592 and CUPVEST2697, respectively. Locus-specific SSR markers are quite practical to determine resistance to disease in rice (Melaku et al. 2018), triploids in apple (Mazeikiene et al. 2019) and sugarcane sex (Pan et al. 2006). Thus, a total of 61 cultivar-specific loci that can identify 34 pistachio cultivars and genotypes presented in this study can be useful in future pistachio breeding programs.

Genetic relationships among pistachio cultivars

The results of SSR-based structural genetic analysis and UPGMA clustering were similar to the genetic relationships of pistachio cultivars were different origins (Turkey, Iran, Italy, Greece, Syria, and Tunisia) in the present study. Kafkas et al. (2006) divided 69 pistachio cultivars into three major clusters (Iranian, Mediterranean and outgroups) by using AFLP, RAPD and ISSR markers. Mediterranean cluster was subdivided to Turkish, Syrian and the closest genotypes to Siirt cv. according to genetic distance. In addition, the similar findings related with clustering were identified by Motalebipour et al. (2016) and Khodaeiaminjan et al. (2018). In genetic characterization studies performed by Khadivi et al. (2018) and Vendramin et al. (2009) Mumtaz and Ohadi were clustered in different groups. However, contrary to their findings, in the current study, they were categorized into the same cluster which agreed with the reports of Kafkas et al. (2006) and Kolahi-Zonoozi et al. (2014). In the current study, Cluster-I can be defined as Iranian cultivars and related genotypes. Cluster-II consisted of Siirt cultivar and genotypes closer to it although Cluster-III included Turkish and Syrian cultivars. Turkish cultivars Kaska, Bagyolu, Atli, and Uygur were replaced in Cluster-IV closer to Turkish and Syrian groups in the UPGMA analysis, while Structure analysis were clearly separated them as separate groups. Male-22 and Male-13 genotypes in Cluster-V were clustered in different group from others (Table 1, Fig. 1). The study performed by Kafkas et al. (2006) supported our results. Kafkas et al. (2006) conducted their study using AFLP, RAPD and ISSR markers and these technics have many disadvantages according to SSR marker technic such as applicable of the automation, less reliability and repeatable. Thus, although the obtained results in this study demonstrated similarity to their research, AFLP, RAPD and ISSR markers are not practical for getting results fast in the laboratory. Consequently, the most polymorphic and cultivars-specific SSR loci obtained from this study can be preferred for identifying cultivars in early stage of nursery and breeding programs for geneticist, breeders and farmers.

In this study, 66 pistachio cultivars and genotypes from different geographic origins were fingerprinted using 92 SSR markers and characterized by three different genetic analyses methods. A robust dendrogram established and all the cultivar and genotypes were grouped at clusters in accord with their geographic origins. SSRs were the most powerful and efficient marker system in cultivar fingerprinting, germplasm characterization, phylogenetic studies. Furthermore, 61 cultivar specific alleles belonging to 34 cultivar and genotypes was also presented for international pistachio community which will be very useful in cultivar identification at early stage of nursery. The results of this study can be used for future studies on genetic diversity, germplasm characterization, and genetic mapping.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgment

The authors thank the University Çukurova, Scientific Research Projects Unit (Project No: FYL-2018-10667) for financial support.)

Afzadi MA, Tabatabaei BES, Mohammadi SA, Tajabadipur A (2007) Comparison of Genetic Diversity in Species and Cultivars of Pistachio (Pistacia sp. L.) Based on Amplified Fragment Length Polymorphism (AFLP) Markers. Iranian Journal of Biotechnology, 5(3): 147-152.
Ahmad R, Ferguson L, Southwick SM (2003) Identification of pistachio (Pistacia vera L.) nuts with microsatellite markers. Journal of the American Society for Horticultural Science, 128(6), 898-903. https://doi.org/10.21273/JASHS.128.6.0898
Ahmad R, Ferguson L, Southwick SM (2005) Molecular marker analyses of pistachio rootstocks by simple sequence repeats and sequence-related amplified polymorphisms. The Journal of Horticultural Science and Biotechnology, 80(3), 382-386. https://doi.org/10.1080/14620316.2005.11511948
Arabnejad H, BaharM, Taj A (2008). Genetic diversity of Pistacia khinjuk Stocks by SSR markers. Agri Sci Tech., 12:207–217.
Arabnezhad H, Bahar M, Pour AT (2011) Evaluation of genetic relationships among Iranian pistachios using microsatellite markers developed from Pistacia khinjuk Stocks. Scientia horticulturae, 128(3), 249-254. https://doi.org/10.1016/j.scienta.2011.01.028
Baghizadeh A, Noroozi S, Jalali-Javaran M (2010) Study on genetic diversity of some Iranian Pistachio (Pistacia vera L.) cultivars using random amplified polymorphic DNA (RAPD), inter sequence repeat (ISSR) and simple sequence repeat (SSR) markers: A comparative study. Afr J Biotech. 9:7632–7640. 10.5897/AJB10.701
Caruso T, Iannini C, Barone E, Marra FP, Sottile F, Greco CI, Sabina MR, Martelli G, Monastra F, Battle I, Vargas F, Romero M, Ak, BE, Zakynthinos G, Padulosi S, Laghezali M (1998) Genetic and Phenotypic Diversity in Pistachio (P. vera L.) Germplasm Collected in Mediterranean Countries. Acta Horticulturae 470: 168-178. 10.17660/ActaHortic.1998.470.23
Dollo L, Hormaza JI, Polito VS (1995) RAPD Polymorphisms among Pistachio (Pistacia vera L.) Cultivars. Fruit Varieties Journal, 49 (3): 147-152.
Doyle JJ, Doyle JL (1987) A rapid isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19: 11-15.
Fan L, Zhang MY, Liu QZ, Li LT, Song Y, Wang LF, ... Wu J (2013) Transferability of newly developed pear SSR markers to other Rosaceae species. Plant Molecular Biology Reporter, 31(6), 1271-1282. https://doi.org/10.1007/s11105-013-0586-z
Faostat (2017) Erişim Tarihi: 19 Ocak 2016, FAO Web Page, (http://www.fao.org).
Golan-Goldhirsh A, Barazani O, Wang ZS, Khadka DK, Saunders JA, Kostiukovsky V (2004) Genetic Relationships among Mediterranean Pistacia Species Evaluated by RAPD and AFLP Markers. Plant Syst. Evol., 246: 9-18. https://doi.org/10.1007/s00606-004-0132-4
Guney M, Kafkas S, Keles H, Aras S, Ercisli S (2018) Characterization of hawthorn (Crataegus spp.) genotypes by SSR markers. Physiology and molecular biology of plants, 24(6), 1221-1230. https://doi.org/10.1007/s12298-018-0604-6
Guney M, Kafkas S, Koc A, Aras S, Keles H, Karci H (2019) Characterization of quince (Cydonia oblonga Mill.) accessions by simple sequence repeat markers. Turkish Journal of Agriculture & Forestry, 43(1). 10.3906/tar-1804-95
Hormaza JI (2002) Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor Appl Genet 104: 321-328. https://doi.org/10.1007/s001220100684
Hormaza JI, Dollo L, Polito VS (1994) Determination of Relatedness and Geographic Movements of Pistacia vera (Pistachio; Anacardiaceae) Germplasm by RAPD Analysis. Economic Botany, 48 (4): 349-358. https://doi.org/10.1007/BF02862231
Kafkas S, Ozkan H, Ak BE, Açar I, Atlı HS, Koyuncu S (2006) Detecting DNA Polymorfism and Genetic Diversity in a Wide Pistachio Germplasm: Comparison of AFLP, ISSR and RAPD Markers. J Am Soc Hortic Sci. 131: 522-529. https://doi.org/10.21273/JASHS.131.4.522
Kafkas S (2019) Advances in breeding of pistachio. Chapter. Burleigh Dodds Science Publishing Limited. Doi.10.19103/AS.2018.0042.17
Kafkas S (2006a) Phylogenetic Analysis of the Genus Pistacia by AFLP Markers. Plant Systematic and Evolution, 262: 113–124. https://doi.org/10.1007/s00606-006-0460-7
Kafkas S (2006b) Phylogeny, Evolution and Biodiversity in the Genus Pistacia (Anacardiaceae). (A.K. SHARMA and A. SHARMA, Editor). Plant Genome, Biodiversity and Evolution. Volume 1, part C, Phanerogams (Angiosperm Dicotyledons), Science Publishers, Enfield(NH), Jersey, Plymouth, USA, pp 526-557.
Kafkas S, Perl-Treves R (2002) Interspecific Relationships in Pistacia Based on RAPD Fingerprinting. Horticultural Science, 37(1): 168-171. https://doi.org/10.21273/HORTSCI.37.1.168
Kafkas S, Perl-Traves R, Kaska N (2000) Unusual Pistacia atlantica Desf. (Anacardiaceae) Monoecious Sex Type in the Yunt Mountains of the Manisa Province of Turkey. Israil J. Plant Sci., 48: 277- 280.
Karimi HR, Kafkas S, Zamani Z, Ebadi A, Fatahi R (2009) Genetic Relationships among Pistacia Species Using AFLP Markers, 5th International Symposium on Pistachios and Almonds. Acta Horticulturae, 912: 617-627. https://doi.org/10.1007/s00606-008-0117-9
Kashaninejad M, Tabil LG (2011) 11 – Pistachio (Pistacia vera L.) A2. In E. M. Yahia (Ed.). Postharvest Biology and Technology of Tropical and Subtropical Fruits (pp. 218–247). Woodhead Publishing.
Khadivi A (2018) Assessment of genetic variability in pistachio (Pistacia vera L.) with nuclear SSR molecular markers. Erwerbs-Obstbau, 60(4), 289-294. https://doi.org/10.1007/s10341-018-0372-z
Khadivi A, Esmaeili A, Mardani N (2018) Genetic diversity of cultivated pistachio as revealed by microsatellite molecular markers. Biotechnology & Biotechnological Equipment, 32(3), 602-609. https://doi.org/10.1080/13102818.2018.1442745
Khodaeiaminjan M, Kafkas S, Motalebipour EZ, Coban N (2018) In silico polymorphic novel SSR marker development and the first SSR-based genetic linkage map in pistachio. Tree Genetics & Genomes, 14(4), 45. https://doi.org/10.1007/s11295-018-1259-8
Kolahi-Zonoozi SH, Mardi M, Zeinalabedini M, et al (2014) Development of 12 new SSR markers for genetic diversity and structure analysis in pistachio (Pistacia vera L.) J Hort Sci Biotech. 89: 707–711. https://doi.org/10.1080/14620316.2014.11513141
Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 35:1547–1549. 10.1093/molbev/msy096
Liu K, Muse SV (2005) PowerMarker: Integrated Analysis Environment for Genetic Marker Data. Bioinformatics, 21: 2128-2129.
Motalebipour EZ, Kafkas S, Khodaeiaminjan M, Çoban N, Gozel H (2016) Genome survey of pistachio (Pistacia vera L.) by next generation sequencing: development of novel SSR markers and genetic diversity in Pistacia species. BMC genomics, 17(1), 998. https://doi.org/10.1186/s12864-016-3359-x
Parfitt DE, Badenes ML (1997) Phylogeny of the Genus Pistacia as Determined from Analysis of the Chloroplast Genome. Proc. Natl. Acad. Sci. USA, 94: 7987–7992. https://doi.org/10.1073/pnas.94.15.7987
Pazouki L, Mardi M, Shanjani PS, Hagidimitriou M, Pirseyedi SM, Naghavi MR, Ghaffari MR (2010) Genetic diversity and relationships among Pistacia species and cultivars. Conservation genetics, 11(1), 311-318. 10.1007/s10592-009-9812-5
Peakall R, Smouse PE (2012) GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research. Bioinformatics 28: 2537-2539. https://doi.org/10.1111/j.1471-8286.2005.01155.x
Potts SM, Han Y, Khan MA, Kushad MM, Rayburn AL, Korban SS (2012) Genetic diversity and characterization of a core collection of Malus germplasm using simple sequence repeats (SSRs). Plant molecular biology reporter, 30(4), 827-837. https://doi.org/10.1007/s11105-011-0399-x
Pritchard JK, Stephens M, Donnelly P (2000) Inference of Population Structure Using Multilocus Genotype Data. Genetics, 155(2): 945–59. https://doi.org/10.1093/genetics/155.2.945
Rohlf FJ (2009) NTSYSpc: Numerical Taxonomy System, ver.2.21c. Setauket: Exeter Publishing.
Rovira M, Battle I, Romero M, Vagas FJ (1995) Isoenymic Identification of Pistacia Species. Acta Horticulturae, 419: 265-272. 10.17660/ActaHortic.1995.419.43
Scheulke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol. 18: 233-234. https://doi.org/10.1038/72708
Topçu H, Kafkas S, Doğan A, Akcay ME, Ercişli S (2015) Genetic relatedness among quince (Cydonia oblonga Miller) accessions from Turkey using amplified fragment length polymorphisms. J Appl Bot Food Qual 88: 197-201. 10.5073/JABFQ.2015.088.028
Tunalıoglu R, Taskaya B (2003) Antepfıstıgı Tarımsal Ekonomi Araştırma Enstitüsü T.E.A.E Bakıs. 5(2): 1-4.
Vendramin E, Dettori MT, Verde I, Micali S, Giovinazzi J, Mardi M (2009) Molecular Characterization of Pistacia Genus by Microsatellite Markers. Acta Horticulturae, Ist Balkan Symp. on Fruit Growing, 825.5. 10.17660/ActaHortic.2009.825.5
Zaloglu S, Kafkas S, Dogan Y, Guney M (2015) Development and Characterization of SSR Markers from Pistachio (Pistacia vera L.) and Their Transferability to eight Pistacia Species. Sci Hortic. 189: 94-103. http://dx.doi.org/10.1016/j.scienta.2015.04.006
Zohary M (1952) A Monographical Study of the Genus Pistacia. Palest. J. Bot. Jerusalem Ser., 5: 187-228.

Table 1 Origins of the pistachio cultivars and genotypes used in this study.

No	Cultivars	Sex	Germplasm	Origin
1	Kalehghouchi	Female	Iran/Gaziantep	Iran
2	Mumtaz	Female	Iran/Gaziantep	Iran
3	Bilgen	Female	Iran/Sanliurfa	Iran
4	Vahidi	Female	Iran/Gaziantep	Iran
5	Sefidi	Female	Iran/Gaziantep	Iran
6	Haciserifi	Female	Iran/Gaziantep	Iran
7	Sirora	Female	Australia/Gaziantep	Syria
8	Kirmizi	Female	Gaziantep	Turkey
9	Sultani	Female	Gaziantep	Turkey
10	Cakmak	Female	Gaziantep	Turkey
11	KetenGomlek	Female	Gaziantep	Turkey
12	Ajamy	Female	Syria/Gaziantep	Syria
13	BeyazBen	Female	Gaziantep	Turkey
14	Sivri	Female	Gaziantep	Turkey
15	Tekin	Female	Gaziantep	Turkey
16	Selection-2	Female	Gaziantep	Turkey
17	Selection-3	Female	Gaziantep	Turkey
18	Selection-4	Female	Gaziantep	Turkey
19	Selection-5	Female	Gaziantep	Turkey
20	Selection-6	Female	Gaziantep	Turkey
21	Selection-7	Female	Gaziantep	Turkey
22	Selection-8	Female	Gaziantep	Turkey
23	Selection-9	Female	Gaziantep	Turkey
24	Selection-10	Female	Gaziantep	Turkey
25	Selection-11	Female	Gaziantep	Turkey
26	Selection-12	Female	Gaziantep	Turkey
27	Selection-13	Female	Gaziantep	Turkey
28	Selection-14	Female	Gaziantep	Turkey
29	Selection-15	Female	Gaziantep	Turkey
30	Selection-16	Female	Gaziantep	Turkey
31	Degirmi	Female	Gaziantep	Turkey
32	Red Aleppo	Female	USDA/Adana	Syria
33	Gialla	Female	Italy/Adana	Italy
34	Halebi	Female	Gaziantep	Turkey
35	Ashoury	Female	Syria/Gaziantep	Syria
36	Siirt	Female	Gaziantep	Turkey
37	Uzun	Female	Gaziantep	Turkey
38	Ohadi	Female	Iran/Gaziantep	Iran
39	KermanUSA	Female	USDA/Gaziantep	Iran
40	KermanSPA	Female	Spain/Gaziantep	Iran
41	White Oleimy	Female	Spain/Adana	Syria
42	Aeginea	Female	USDA/Adana	Greece
43	T.Silvana	Female	Italy/Gaziantep	Italy
44	Sfax	Female	USDA/Adana	Tunusia
45	12-2	Female	Gaziantep	Turkey
46	14-107	Female	Gaziantep	Turkey
47	16-20	Female	Gaziantep	Turkey
48	19-112	Female	Gaziantep	Turkey
49	21-130	Female	Gaziantep	Turkey
50	23-102	Female	Gaziantep	Turkey
51	1-76	Male	Gaziantep	Turkey
52	16-32	Male	Gaziantep	Turkey
53	21-125	Male	Gaziantep	Turkey
54	25-90	Male	Gaziantep	Turkey
55	9-64	Male	Gaziantep	Turkey
56	Atli	Male	Gaziantep	Turkey
57	Uygur	Male	Gaziantep	Turkey
58	Kaska	Male	Gaziantep	Turkey
59	Bagyolu	Male	Manisa	Turkey
60	Peters	Male	Spain/Gaziantep	Iran
61	M3	Male	Italy/Adana	Syria
62	M7	Male	Italy/Adana	Syria
63	Male-7	Male	Gaziantep	Turkey
64	Male-13	Male	Gaziantep	Turkey
65	Male-22	Male	Gaziantep	Turkey
66	Male-23	Male	Gaziantep	Turkey

Table 2 Summary of SSR primer pairs developed from pistachio in pistachio cultivars.

No	Origin and reference	Acronyms	No. of tested loci	No. of non-amplified loci	Monomorphic	Polymorphic	Polymorphism rate (%)
1	Khodaeiaminjan et al. (2018)	CUPSiOh, CUPSiPa, CUPOhBa, CUPBaPa, CUPSiBa,	74	-	-	74	100
2	Zhaanbaev (2018)	CUPVEST	26	8	8	18	69.23

	Total		100	8	8	100

Table 3 Allele range, number of alleles (Na), number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He) and polymorphism information content (PIC) values based on 92 SSR loci developed from Pistacia vera L.

No	SSR loci	Repeat Motif	Annealing Temp °C	Na	Ne	Ho	He	PIC
1	CUPSiOh2424	(TC)₁₂	58	10.000	5.90	0.52	0.83	0.70
2	CUPSiOh1097	(AG)₁₃	58	6.000	4.58	1.00	0.78	0.67
3	CUPSiOh1163	(TC)₁₈	58	6.000	3.85	0.69	0.74	0.63
4	CUPSiOh1613	(GT)₁₆	58	4.000	2.62	0.53	0.62	0.65
5	CUPSiOh1818	(TA)₈(TG)₁₆	56	7.000	4.05	0.79	0.75	0.63
6	CUPSiOh1913	(GA)₁₃	58	6.000	2.36	0.40	0.58	0.72
7	CUPSiOh1938	(TAGTAT)₄	58	6.000	4.28	0.70	0.77	0.64
8	CUPSiOh196	(TC)₁₄	58	7.000	4.51	0.51	0.78	0.75
9	CUPSiOh2079	(GTTGGT)₅(GGT)₄	58	6.000	3.44	0.78	0.71	0.60
10	CUPSiOh216	(AAAT)₆	58	11.000	4.88	0.83	0.79	0.64
11	CUPSiOh2311	(AG)₁₆	58	4.000	1.66	0.20	0.40	0.81
12	CUPSiOh2460	(AC)₁₈	58	6.000	3.43	0.81	0.71	0.87
13	CUPSiOh2635	(TC)₁₂	58	4.000	1.95	0.48	0.49	0.60
14	CUPSiOh2679	(AC)₁₁	58	6.000	2.05	0.53	0.51	0.61
15	CUPSiOh2834	(AG)₁₆	58	5.000	2.93	0.38	0.66	0.77
16	CUPSiOh2951	(TGG)₉	58	5.000	2.45	0.49	0.59	0.59
17	CUPSiOh2985	(AG)₁₂	58	9.000	3.80	0.98	0.74	0.46
18	CUPSiOh3328	(AC)₁₂(AT)₈	58	4.000	3.31	0.68	0.70	0.75
19	CUPSiOh3348	(AG)₁₉	58	7.000	4.40	0.60	0.77	0.69
20	CUPSiOh3593	(TC)₁₃	58	9.000	5.25	0.72	0.81	0.72
21	CUPSiOh3646	(TC)₁₅	58	6.000	2.11	0.60	0.53	0.75
22	CUPSiOh3660	(AGCCTC)₅	58	6.000	3.51	0.59	0.72	0.53
23	CUPSiOh3668	(AG)₁₃	58	8.000	3.59	0.59	0.72	0.60
24	CUPSiOh3822	(TCT)₁₀	58	5.000	2.26	0.59	0.56	0.58
25	CUPSiOh3876	(TC)₂₁	58	6.000	2.63	0.51	0.62	0.67
26	CUPSiOh3920	(GAT)₄CTATTTATCGCAG(AGGCTC)₄	58	7.000	2.51	0.50	0.60	0.43
27	CUPSiOh4004	(TG)₁₃	58	6.000	2.80	0.54	0.64	0.68
28	CUPSiOh4055	(TC)₂₁	58	2.000	1.28	0.13	0.22	0.70
29	CUPSiOh4057	(AC)₁₈	58	7.000	2.31	0.59	0.57	0.54
30	CUPSiOh4074	(TC)₁₂	58	8.000	2.65	0.56	0.62	0.30
31	CUPSiOh4084	(AG)₁₅	58	3.000	1.79	0.27	0.44	0.80
32	CUPSiOh4341	(GT)₁₅	58	7.000	3.05	0.56	0.67	0.77
33	CUPSiOh527	(CT)₁₄ATAC(AT)₆	58	4.000	3.01	0.43	0.67	0.44
34	CUPSiOh810	(TG)₁₃	58	7.000	3.11	0.68	0.68	0.71
35	CUPSiPa1215	(AACCCT)₅	58	11.000	4.48	0.75	0.78	0.46
36	CUPSiPa1583	(GA)₁₁	58	4.000	1.58	0.33	0.37	0.38
37	CUPSiPa1937	(AAGTAG)₆	58	8.000	4.25	0.79	0.76	0.73
38	CUPSiPa2132	(AG)₁₇	58	6.000	2.12	0.37	0.53	0.60
39	CUPSiPa3096	(TTA)₉(TCA)₆	58	11.000	5.72	0.80	0.83	0.64
40	CUPSiPa3520	(CT)₁₉	58	10.000	5.97	0.84	0.83	0.68
41	CUPSiPa3929	(TTA)₉	58	9.000	4.83	0.98	0.79	0.74
42	CUPSiPa4715	(TC)₁₁	58	7.000	3.44	0.52	0.71	0.74
43	CUPSiPa694	(AAT)₁₀	58	5.000	1.33	0.23	0.25	0.65
44	CUPSiPa912	(TGAGTG)₅	58	4.000	2.34	0.48	0.57	0.65
45	CUPOhBa1592	(CA)₁₄	58	20.000	8.12	0.96	0.88	0.65
46	CUPOhBa3951	(TAT)₉	58	6.000	3.25	0.89	0.69	0.62
47	CUPOhBa4461	(TC)₁₄	58	9.000	3.52	0.47	0.72	0.58
48	CUPOhPa1527	(AAT)₁₀	58	8.000	2.99	0.85	0.67	0.55
49	CUPOhPa3361	(TGATGC)₅	58	9.000	2.96	0.69	0.66	0.33
50	CUPOhPa995	(AAT)₉	58	8.000	4.48	0.77	0.78	0.51
51	CUPBaPa1355	(TG)₁₅	58	6.000	4.08	0.74	0.75	0.51
52	CUPBaPa1690	(TTTCT)₆	58	6.000	2.49	0.52	0.60	0.58
53	CUPBaPa2540	(ATT)₁₁	58	5.000	2.93	0.66	0.66	0.58
54	CUPBaPa394	(TC)₁₄	58	5.000	3.64	0.67	0.73	0.61
55	CUPBaPa667	(GA)₂₀	58	6.000	3.35	0.33	0.70	0.44
56	CUPBaPa992	(CT)₁₂	58	4.000	1.58	0.21	0.37	0.74
57	CUPSiBa1265	(TC)₁₁	58	7.000	2.58	0.69	0.61	0.81
58	CUPSiBa1131	(AAG)₉	58	4.000	1.49	0.27	0.33	0.81
59	CUPSiBa613	(AC)₁₂	58	5.000	3.23	0.71	0.69	0.75
60	CUPSiBa4598	(ATC)₁₀	58	7.000	3.16	0.85	0.68	0.69
61	CUPSiBa3976	(AG)₁₄	58	4.000	2.09	0.48	0.52	0.54
62	CUPSiBa1817	(AAT)₁₀(TAT)₆	58	9.000	4.45	0.32	0.78	0.35
63	CUPBaPa1791	(TATC)₃CTGCAGCATTAATTTTACATAAATATAGACTC(TTCACG)₄	58	6.000	3.78	0.71	0.74	0.66
64	CUPSiOh2390	(TC)₁₅	58	6.000	2.92	0.48	0.66	0.41
65	CUPSiOh4570	(GGAGCA)₇	58	6.000	2.77	0.52	0.64	0.20
66	CUPSiPa3487	(AG)₁₁	58	3.000	2.88	0.65	0.65	0.33
67	CUPSiOh159	(TG)₁₁	58	5.000	2.96	0.65	0.66	0.24
68	CUPOhBa2127	(AG)₁₈	58	16.000	5.65	0.69	0.82	0.61
69	CUPSiOh2178	(TG)₁₄	58	5.000	2.62	0.57	0.62	0.49
70	CUPSiBa3919	(TC)₁₂	58	6.000	2.91	0.80	0.66	0.79
71	CUPOhPa2500	(CA)₁₃	58	11.000	4.01	0.56	0.75	0.55
72	CUPSiBa4207	(CT)₁₄	58	6.000	1.84	0.46	0.46	0.40
73	CUPSiBa2591	(AC)₁₅	58	6.000	3.90	0.59	0.74	0.50
74	CUPSiBa3914	(AG)₁₁	58	3.000	1.72	0.44	0.42	0.56
75	CUPVEST1013	(GATCAC)₄	58	5.000	3.77	0.68	0.73	0.69
76	CUPVEST1424	(ATTA)₅	58	6.000	2.93	0.57	0.66	0.62
77	CUPVEST1747	(AT)₁₁	58	6.000	3.21	0.53	0.69	0.63
78	CUPVEST1852	(CCATCA)₄	58	4.000	1.27	0.20	0.21	0.20
79	CUPVEST2139	(AG)₁₀	58	6.000	2.72	0.83	0.63	0.58
80	CUPVEST2697	(TTG)₇	58	6.000	2.29	0.64	0.56	0.52
81	CUPVEST2736	(TTC)₈	58	5.000	3.13	0.48	0.68	0.62
82	CUPVEST2789	(AG)₁₂	58	7.000	4.47	0.63	0.78	0.75
83	CUPVEST2878	(CTT)₇	58	2.000	2.00	0.38	0.50	0.37
84	CUPVEST2939	(TCA)₇	58	3.000	1.08	0.08	0.07	0.07
85	CUPVEST3063	(ATA)₇	58	5.000	2.38	0.58	0.58	0.52
86	CUPVEST3504	(ATA)₇	58	7.000	3.19	0.73	0.69	0.65
87	CUPVEST4634	(TGGTCT)₄	58	2.000	1.85	0.34	0.46	0.35
88	CUPVEST5301b	(TGGGG)₄	58	4.000	2.59	0.45	0.61	0.53
89	CUPVEST5880	(GAT)₇	58	3.000	2.08	0.72	0.52	0.41
90	CUPVEST704	(GGAACC)₄	58	5.000	2.77	0.59	0.64	0.57
91	CUPVEST8104	(TTTA)₅	58	3.000	1.73	0.00	0.42	0.38
92	CUPVEST910	(TTATG)₄	58	5.000	2.69	0.73	0.63	0.57
	Mean			6.26	3.14	0.58	0.63	0.58

PistachioSupplementaryTables08102021.xlsx
Supplementary Tables

Download PDF

Reviews received at journal
09 Dec, 2021
Reviewers invited by journal
08 Dec, 2021
Editor assigned by journal
23 Nov, 2021
First submitted to journal
22 Nov, 2021

You are reading this latest preprint version

Revealing Genetic Diversity, Population Structure and Cultivar-Specific SSR Alleles in Pistachio Using SSR Markers

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Conclusions

Declarations

References

Tables

Supplementary Files

Status:

Version 1