Animals
MRL/lpr mice were purchased from SLC Inc. (Japan). C57BL/6 mice were purchased from OrientBio (Korea). Niclosamide (Sigma-Aldrich, St Louis, MO, USA) was resuspended in 0.5% methyl cellulose (Sigma-Aldrich, St Louis, MO, USA) for in vivo studies or in 5% DMSO for in vitro use. Female 10-week-old MRL/lpr mice received daily administration of vehicle (n = 7) or Niclosamide (n = 7; 100 mg/kg) for 7 weeks by oral gavage. All mice were sacrificed at 16weeks of age. Female 8-week-old C57BL/6 mice were treated via epicutaneous application of 50 μg of the TLR7 agonist resiquimod (R848; Sigma-Aldrich) dissolved in 10 μl of acetone, with or without 10 mg/kg of Niclosamide daily for 4 weeks, or acetone alone as a control, to the right ear three times a week until euthanasia. All procedure of animal research were provided in accordance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals and the Guidelines and Policies for Rodent experiment provided by the IACUC(Institutional Animal Care and Use Committee) in school of medicine, The Catholic University of Korea. (Approval numbers: CUMS-2018-0341-02 and 2018-0236-02).
Enzyme-linked immunosorbent assay (ELISA)
Cytokines in sera or spleen lysates were assayed using mouse IL-6 and IL-21 Duoset ELISA kits (R&D systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The serum levels of anti-dsDNA IgG antibodies were measured by ELISA following the manufacturer’s instructions (Alpha Diagnostics, San Antonio, TX, USA). Total IgG, IgG1, IgG2a, and IgM levels in the sera of the mice were measured by ELISA following the manufacturer’s instructions (Bethyl Laboratories, Montgomery, TX, USA).
Measurement of urine albumin to creatinine ratio
Urine albumin and creatinine concentrations were measured using a mouse albumin ELISA assay (Bethyl Laboratories) and a creatinine assay (R&D systems), respectively, according to the manufacturer’s directions. Urine albumin excretion was expressed as the ratio of urine albumin to creatinine (ACR).
Histological assessment of the kidney
Kidney tissues were fixed with formalin and embedded in paraffin, cut into 3 μm sections, and stained with periodic acid–Schiff (PAS) stain. Kidney histological pathology was evaluated using the lupus nephritis classification system, as described [24].
Immunofluorescence
Kidney tissues were stained with anti-C3 (Abcam, Cambridge, UK) at 4 °C overnight, followed by 2 h incubation with secondary antibodies conjugated to Alexa488. Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, Carlsbad, CA, USA). Isotype control staining was conducted via probing with rat/rabbit/mouse IgG, rather than primary antibodies. Confocal images were acquired using an LSM 800 confocal microscope (Zeiss, Oberkochen, Germany).
Flow cytometry
Spleens were minced in RPMI 1640 medium and filtered through a 40-μm cell strainer to prepare single-cell suspensions. For intracellular staining, cells were stimulated with 25ng/mL phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich) and 250ng/mL ionomycin (Sigma-Aldrich) with monensin-containing GolgiStop (BD biosciences, San Jose, CA, USA) for 5h. Cells were harvested and stained with surface eFluor780-fixable viability dye (FVD) (eBioscience, Carlsbad, CA, USA), Pacific Blue-anti-CD90.2 (Biolegend, San Diego, CA, USA), PerCP-Cy5.5-anti-CD4 (Biolegend), FITC-anti-CXCR5 (Biolegend), Brilliant Violet 605-anti-PD-1 (Biolegend), APC-anti-CD19 (Biolegend), PE-anti-CD138 (BD Biosciences), and Alexa Fluor A488-anti-GL7 (eBioscience) antibodies. Blood samples were collected from the retro-orbital sinus. Red blood cell were lysed with an ammonium-chloride-potassium lysis buffer, then stained with surface eFluor 780-Fixable viability dye (eBioscience), Pacific Blue-anti-CD90.2, PerCP-Cy5.5-anti-CD4, and PE-anti-CD8 antibodies. Flow cytometric analysis was performed on a LSRII Fortessa (BD biosciences), and the data were analyzed using FlowJo software (Tree Star, Ashland, OR, USA).
Western Blot
Total protein was extracted using RIPA buffer containing Halt protease/phosphatase inhibitor cocktail (Thermo Fisher Scientific, Rockford, IL, USA). For immunoblotting, 30 μg of protein was separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), then transferred onto polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA, USA), and probed with the following antibodies: anti-p-STAT3Y705, anti-STAT3, anti-Bcl-6, anti-TCF-1 (Cell signaling technology, Danvers, MA, USA), and anti-β-actin (Sigma-Aldrich). Subsequently, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (Thermo Fisher Scientific). Reactive proteins on the membrane were visualized using SuperSignal® West Pico Chemiluminescent substrate (Thermo Fisher Scientific), and the membrane was then exposed on an Amersham Imager 600 (GE healthcare, Healthcare, Chicago, IL, USA).
Real-time PCR
Total RNA was collected using an RNA iso plus reagent (Takara, Kusatsu, Japan). Up to 1 ~ 2 µg of total RNA was converted to complementary DNA using a Transcriptor First-Strand cDNA Synthesis kit (Roche Diagnostics, Penzberg, Germany). A LightCycler 96 instrument (Roche) was used for PCR amplification and analysis. All reactions were performed with SYBR Green I Master Mix, according to the manufacturer’s instructions. Primers were designed using the web tool from GenScript® (http://www.genscript.com). Sequences are as follows (forward and reverse, respectively): beta actin, 5′- GGACTTCGAGCAAGAGATGG -3′ and 5′- TGTGTTGGGGTACAGGTCTTT -3′; Bcl-6, 5′- GCCGGCTCAATAATCTCGTGAACA -3′ and 5′- CCAGCAGTATGGAGGCACATCT -3′; CXCR5, 5′- ACTCCTTACCACAGTGCACC -3′ and 5′- GGAAACGGGAGGTGAACCA -3′; and Blimp-1, 5′- ATGGAGGACGCTGATATGAC -3′ and 5′- CCTTACTTACCACGCCAATAAC -3′. All mRNA expression levels were normalized to beta actin expression. Relative fold induction was calculated, following the equation 2-(∆Cq) or 2-(∆∆Cq), where ∆∆Cq is ∆Cq(target) - ∆Cq(beta actin), ∆Cq is Cq(stimulated)-Cq(unstimulated), and Cq is the cycle at which the threshold is crossed. PCR product quality was monitored using post-PCR melting curve analysis.
TFH-like cell differentiation
CD4+ T cells were purified from spleens of MRL/lpr and C57BL/6 mice using the CD4+ T cell Isolation Kit (Miltenyi Biotec, Bisley, UK) according to the manufacturer’s instructions. For TFH-like cell differentiation, purified CD4+ T cells were seeded at 1 × 106 cells/well and were activated with mouse T-activator CD3/CD28 DynabeadsTM (Invitrogen), and treated with 20 ng/ml IL-6, 20 ng/ml IL-21, 10 μg/ml anti-IL-4, 10 μg/ml anti-IFN-γ, and 20 μg/ml anti-TGF-β (R&D Systems) for 4 days with or without Niclosamide.
Co-culture of mouse B cells and TFH-like cells
TFH-like cells from spleens of C57BL/6 mice were first cultured for 4 days with or without Niclosamide. B cells were purified from spleens of C57BL/6 mice using a B cell Isolation kit (Miltenyi Biotec) according to the manufacturer’s instructions. CD19+ B cells were co-cultured with TFH-like cells (1 × 106 cells/well, 1:1 ratio) and were stimulated with 50 ng/ml IL-4 (PeproTech, Rocky Hill, NJ, USA), 5 μg/ ml anti-IgM (Jackson ImmunoResearch, West Grove, PA, USA), and 5 μg/ml anti-CD40 (eBioscience) in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Carlsbad, CA, USA) with 10% FBS for 3 days. IgG were measured using an ELISA kit (Bethyl Laboratories).
Statistics analysis
Statistical analyses were performed in GraphPad Prism version 7.0 software (GraphPad, San Diego, CA, USA). Statistical significance was determined by t-tests for two groups, and by one-way ANOVA with Tukey’s multiple comparisons tests for three or more groups. P < 0.05 was considered statistically significant.