Cell culture and transfection
Human cell lines HEK293T, Hela, SHSY5Y, H1299, HCT116, SMMC-7721, HepG2, Hskmc and Hepatocyte were cultured in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum), 100 U/ml penicillin and 100 mg/ml streptomycin (all from Gibco, USA) in a 37℃ humidified atmosphere of 5% CO2. Plasmids that used in this study were transfected into Hela cells using a Lipofectamine 2000 (Life Technologies, USA) according to the manufacturer's instructions.
Plasmid construction
The shRNAs for p62S and TRIM72 were synthesized as oligos (Biosune, China), annealed and inserted into the pLKO.1 vector that was digested with EcoRI and AgeI (NEB, USA), the specific sequences for shRNAs seen in Table 1. The plasmids containing p62S, p62L and TRIM72 were amplified from the cDNA human HEK293T or Hela cells, and inserted into pCADNA3.0, pET22B, pACT2, pGBKT7 or pGEX4T-1 vector. The plasmids of TRIM72 (ΔRING) and TRIM72 (C14A) were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, USA). Plasmids that expressing Ubiquitin (pRK5-HA-UB) were kindly provided by Professor Ronggui Hu (Chinese Academy of Sciences, Shanghai, China).
Table 1
Sequences of the shRNAs for p62S and TRIM72.
shRNA | Target site sequence (5'3') |
Scramble | GCGCGATAGCGCTAATAATTT |
shp62S | CAGTTTGGCGTGCAACATGGG |
shTRIM72 | CAGACTGAGTTCCTCATGAAA |
Reverse transcription PCR (RT-PCR) and quantitative PCR (qPCR)
Total RNA was extracted from Hela cells using the RNAsimple total RNA kit (Tiangen, China) according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo, Japan). Reverse transcription PCR (RT-PCR) were performed with 2xTaq MasterMix (Tiangen, China) on gene amplification system (BIOER, China) to assess the abundances of p62S and p62L mRNAs in different cell lines using specific primers (Table 2), GAPDH acts as internal control. Quantitative PCR (qPCR) was performed on ABI 7500 fast real-time PCR system (ABI, USA) to assess the relative abundances of p62S and p62L mRNAs using specific primers (as primers used in RT-PCR) with staining by SYBR Green (Selleck, China). The relative abundances of p62S and p62L were normalized to that of the GAPDH gene, using the ΔΔCt method, and data were obtained from three independent experiments.
Table 2
Sequences of the primers used in RT-PCR and qPCR.
Target gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
GAPDH | GAGTCAACGGATTTGGTCGTATTG | ATTTGCCATGGGTGGAATCATATTG |
p62L | GCCTACCTTCTGGGCAAGGA | ACTGGAAAAGGCAACCAAGTC |
p62S | CTGAACTAAGGAGAAAGTCCTACA | GTTCCTACCACAGGCCCATT |
Yeast two-hybrid screening
The p62S ORF (open reading frame) was cloned into pGBKT7, generating the bait plasmid, pGBKT7-P62S, which contained the in-frame fusion of GAL4 DNA binding domain. Yeast two-hybrid (Y2H) screening was performed by transforming yeast strain (Mav203 strain) that harbored bait vector, with the pACT2 prey vectors for human E3 cDNA expression library. Yeast transformants were first grown on to the plate on SD-2 (deficient in Leu, Trp) for selection of yeast cells containing both bait and prey vectors, and then transferred to SD-4 (deficient in Leu, Trp, His and Ura) plates to screen for E3 ligase proteins that potentially interact with human p62S. The interaction was confirmed by transforming yeast Mav203 cells with the indicated bait and prey vectors, and allowing the transformants to grow on the SD-2 or SD-4 agar plates for approximately 3 days at 30℃. Images of the colonies on both plates were recorded.
Co-immunoprecipitation, immunoprecipitation and immunoblotting
For co-immunoprecipitation (Co-IP), Hela cells transfected with plasmids were lysed in 800µl Co-IP buffer (50mM Tris-HCl, 150mM NaCl, 5mM EDTA and 1% NP-40, PH 7.4) supplemented with a protease inhibitor cocktail (Roche, USA), cell lysates were centrifuged at 4℃ with 13,000g for 10min, incubated with Anti-myc immunomagnetic beads (L-1010, Biolinkedin Biotech, China) overnight at 4℃, washed three times with Co-IP buffer. For immunoprecipitation, Hela cells transfected with plasmids were lysed in 1ml immunoprecipitation (IP) buffer (50mM Tris-HCl, 150mM NaCl, 5mM EDTA, 0.1% SDS and 1% NP-40, PH 7.5) supplemented with a protease inhibitor cocktail, cell lysates were centrifuged at 4˚C with 15,000g for 10min, incubated with anti-Flag affinity gels (L-1013, Biolinkedin Biotech) overnight at 4℃, washed three times with IP buffer. The immunoprecipitates from Co-IP and IP were denatured at 100℃ for 10 min in 2X SDS-PAGE loading buffer. The inputs, immunoprecipitates and other cell lysates were subjected to SDS-PAGE, transferred to a PVDF membrane (Bio-Rad, USA), the membrane was blocked with 10% non-fat milk at room temperature for 1 hour, then incubated with the appropriate antibodies against p62 (made in our laboratory), GAPDH (1:5000, 60004-1-Ig, ProteinTech, China), Myc tag (1:2000, 16286-1-AP, ProteinTech), Flag (1:5000, 20543-1-AP, ProteinTech), ubiquitin (1:500, sc-47721, Santa Cruz, USA), HA (1:2000, SAB3500908, Sigma, USA), TRIM72 (1:500, 22151-1-AP, ProteinTech) or LC3 (1:1000, L7543, Sigma) overnight at 4℃, washed three times with TBST (50mM Tris-HCl, 150mM NaCl and 0.1% Tween-20, PH 7.4), then incubated with HRP-conjugated secondary antibodies (goat anti-mouse IgG (H+L), SA00001-1, 1:5000 dilution; goat anti-rabbit IgG(H+L), SA00001-2, 1:5000 dilution, ProteinTech) at room temperature for 1 hour, washed three times with TBST, and the signals were detected by enhanced chemiluminescence (ECL, 180-5001, Tanon Science and Technology, China) with exposure to X-ray film. The density of bands was calculated with Image J 1.8.0 (Rawak Software, Germany) when needed.
Expression and purification of recombinant proteins
The pGEX4T-1-GST-p62S, pGEX4T-1-GST-p62L and pET22b-LC3-His6 plasmids were expressed in BL21 E. coli, monoclonal were picked, cultured in 37ºC in 2ml LB medium (10g/L Tryptone, 10g/L Yeast extract and 10g/L NaCl) with respective resistance overnight, then transfer the bacterial to 500ml LB medium and cultured for 6 hours at 37℃, following isopropyl-β-d-thiogalactopyranoside (IPTG, Sangon, China) induction at 16℃ overnight. Next day, bacterial cells were centrifuged and lysated in PBS buffer, incubated with glutathione or Ni2+TA beads (GE Healthcare) to enrich the respective proteins, followed by elution with 50mM reduced L-glutathione or with 1M imidazole dissolved in PBS buffer. The eluted products were dialyzed in PBS buffer supplemented with 15% glycerol prior to being aliquoted and preserved at -80℃.
GST pull-down assay
Purified LC3-His6 (50µg), GST-p62S (50µg), GST-p62L (50µg) and Glutathione Sepharose 4B were incubated at 4℃ overnight in 1ml pull-down buffer (20mM Tris-Cl, 100mM NaCl, mM MgCl2, 1mM EDTA, 1mM DTT, 0.5%NP-40 and 20µg/ml BSA, pH 7.6). The beads were centrifuged with 2,000g at 4℃, and washed five times with pull-down buffer. Subsequently, the recovered beads were denatured at 100℃ for 10 min in 2X SDS-PAGE loading buffer and subjected to immunoblotting analysis.
Fluorescence microscopy analysis
Hela cells were transfected with plasmids contain GFP-LC3, p62S, TRIM72 or its mutants, treated with Rapamycin (2µM) for 12 hours, fixed with 4% paraformaldehyde for 20 min, and the cell nucleus was counterstained with 4, 6-diamidino-2-phenylindole (DAPI). The fluorescence microscopy analyses were carried out on Olympus BX51 microscope. Puncta formation by GFP-LC3 was quantitated as follows: n=200 cells assessed from three fields in three independent experiments.
Detection of the cellular oxidatively damaged cellular proteins
Hela cells were tranfected with plasmids contain p62S, TRIM72 or its mutants, treated with or without Rapamycin (2µM) for 12 hours. Protein oxidation was determined using OxyBlot Protein Oxidation Detection Kit (Millipore, USA), according to the manufacturer’s instruction as previously described[11, 12]. Briefly, cell lysates were incubated for 20min with 12% SDS, derivatized with DNP (2,4-dinitrophenylhydrazine), stopped by Oxyblot Neutralization solution and 3µg of total proteins for each sample were resolved in SDS-PAGE, followed transferred to nitrocellulose membranes. The membranes were blocked with the blocking buffer for 45min at room temperature before incubation with antibodies against DNP (1:2000, D9656, Sigma, USA) for two hours, and subsequently with goat anti-rabbit HRP (horseradish peroxidase)-coupled secondary antibodies (1:5000, ProteinTech) for 1 hour at room temperature. Finally, the signals were detected by enhanced chemiluminescence (ECL) with exposure to X-ray film.
Salmonella infections assay
An overnight culture of Salmonella strain SL1344 was diluted 1:25 and bacteria were grown at 37℃ until the OD600 was typically 1.0-1.2. Hela cells were transfected with plasmids contain p62S, p62L, TRIM72 or its mutants for 48 hours, washed twice with PBS and infection was performed in antibiotic-free medium at multiplicity of infection of 100. Salmonella were allowed to invade cells for 30 min, washed three times with PBS. Then cells were lysed and subjected to plate assay. The Salmonella colony numbers were counted and calculated. The experiment was repeated three times.
Statistics
Data were analyzed by two tailed unpaired t-test or one-way ANOVA with Bonferroni post-hoc test using Graph-Pad Prism 7 (GraphPad Software Inc., USA). *P < 0.05 was considered to be of significant difference; **P < 0.01 was considered to be of very significant difference.