5.1 Construction and packaging of Sirt1 interference plasmid
According to the design principles of shRNA and the nucleotide sequence of Sirt1 gene in GenBank (NM_019812.3), two Sirt1 shRNA sequences were designed. Forwardoligo and reverseoligo of sh-Sirt1A as follows: CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG;AATTCAAAAACGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCG; Forwardoligo and reverseoligo of sh-Sirt1B as follows: CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG;AATTCAAAAAGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGC. The synthesized single-stranded oligonucleotides were annealed to form double-stranded DNA, and then ligated with plko.1 by restriction enzyme BshTⅠ/EcoRⅠ. Then the competent bacterium DH5a was transformed and a single colony was selected and sequenced. The colonies with correct sequencing results were amplified to extract the target plasmids.
We transfected the target plasmids, together with lentivirus vectors PAX8 and VSVG, into HEK293T cells for lentivirus packaging. The knockdown efficiency of obtained Sirt1 interference lentivirus were verified by Quantitative PCR in Mouse glioma cells Gl261. Briefly, we first transfected G1261 cells with lentivirus for 1 week. Then, total RNA was extracted from cells with a TRIzol reagent (Gibco, 15596018) according to the manufacturer’s instructions. Then RNA was reverse transcribed into cDNA with an RT-PCR kit (Accurate Biology, AG11705). Quantitative real-time RT-PCR (RT-qPCR) was carried out on a Mx3005p real-time polymerase chain-reaction system (Agilent Technologies, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q311-02) and the temperature was set as follows: initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 s at 95°C, 20 s at 58°C, and 45 s at 72°C. The PCR primers were designed as follows: forward, 5-GTGGCAGTAACAGTGACAGTGG-3; reverse, 5-TCCAGATCCTCCAGCACATTCG-3. The Sirt1 mRNA expression was normalized comparing to rpo. For transfection in vivo, the target plasmids were packaged with AAV by Lianyungang ChuangRui Biological Product Trading Company Ltd. (Jiangsu, China). The final titer of Sirt1 knockdown AAV (AAV-CMV-shSirt1-EGFP) and the no-load control AAV (AAV-CMV-EGFP) was 7.1×1012 vp/mL and 3.5×1012 vp/mL, respectively.
5.2 Animals
C57BL/6J mice (8 months old, male, 35-40 g) were purchased from Beijing HFK Bioscience Co. Ltd. (Beijing, China). The mice were used for experiments at least 14 days after acclimatization to laboratory conditions. The mice were placed in polycarbonate cages with 3-5 mice per cage at a controlled temperature (22 ± 1°C) for 12-h light-dark cycle and ad libitum access to food and water. All animal experiments were performed in accordance to Animal Research: Reporting of In Vivo Experiments (ARRIVE guidelines)[45] and the guidelines of Institutional Animal Care and Use Committee at Tianjin Medical University (IACUC number E2015093) and following reported protocols[46, 47].
5.3 Hippocampal Sirt1 knockdown in aged mice
The mice were randomly divided into three groups, each consisting of 14-16 mice: the untreated mice (control), the mice injected with AAV-CMV-EGFP (sham), and the mice injected with AAV-CMV-shSirt1-EGFP (shSirt1). The mice were anesthetized with inhalation of 2% isoflurane throughout the process by a small animal anesthesia machine (R510-22, RWD Life Science Co., Ltd., China). Then the mice were fixed on a stereotactic apparatus (G1124701, RWD Life Science Co., Ltd., China). Both AAV-CMV-EGFP and AAV-shSirt1-EGFP were diluted to 3.5 × 1012 vp/mL. Bilateral injection with 1 µL of above AAV was performed into the dorsal hippocampal CA1 region, and stereotaxic coordinates were shown as follows: AP -2.00mm, ± ML 1.5mm, DV -1.0mm from bregma. The injection rate was controlled at 100 nL/min. The needle syringe was left in place for about 10 min before being withdrawn. The scalp was sutured, disinfected with iodophor, and the mice were kept warm. After awakening from anesthesia, they were put back into the cage. After three weeks, the construction of Sirt1 knockdown in mouse hippocampus was considered successful [48].
5.4 Fluorescence staining of frozen mouse brain sections
Mice were anesthetized with 3% isoflurane and executed by cervical dislocation. Then, mice were perfused with 20 mL 4% paraformaldehyde (Biosharp, China). Next, the whole brains were isolated properly and fixed in paraformaldehyde overnight. After dehydration in 10% sucrose solution (10% m/v sucrose in PBS) for 2 days, the brains were embedded into optimal cutting temperature compound (OCT) (Sakura, Japan) and frozen in -80°C for 1 day. The brains were sectioned into 20 µm slices at -22°C. The slices were collected on adhesion microscope slides (CITOTEST Scientific, China) and stained with DAPI. Finally, processed slices were observed and filmed by an Olympus IX73 inverted microscope (Japan).
5.5 3T brain structural MRI
The mice were anesthetized 15 min MRI scanning by intraperitoneal injection with 4% chloral hydrate at 0.2 mL/10g. Then the mice were fixed on a semi-circular small animal scanning frame, their limbs were fixed with medical tape, and their heads were fixed by hanging a thin wire through the incisors. MRI was performed on a 3T MRI scanner (DISCOVERY MR750, General Electric, USA) with a mouse brain coil. The parameters for 3D T1-weighted fast acquisition of the whole mouse brain were as follows: repetition time (TR) = 12.6 ms, echo time (TE) = 6.0 ms, field of view (FOV) = 3.0×1.0 mm, slice thickness = 0.3 mm, number of slices = 1746, frequency = 180, phase = 150, prep time = 500 ms, flip angle = 12°, bandwidth = 15.63, locs per slab = 128, number of excitations = 4, and scan time = 20 min 9 s. For voxel-based morphometry (VBM) analysis, obtained MR DICOM files were subjected to conversion to NIFTI files using dcm2niix, augmentation of the voxel size 14 times using DPABI [49], automatic segmentation of hippocampus based on Turone Mouse Brain Atlas and Template (TMBTA) using SPM12 software [50]. In the case of regression of the total intracranial volume, the two-sample t-test was used to analyze the difference in gray matter volume between the three groups within the hippocampus.
5.6 Open field test
Open field test (OFT) is a common animal behavior experiment to detect the loco-motor activity and exploratory behavior of mice. The open field apparatus (RWD Life Science Co., Ltd., China) consisted of a square arena (50 × 50 cm) with walls 45 cm high. The arena was divided into the center area (30 cm × 30 cm square) and the peripheral area. The mice arrived at the test site 24 h in advance to ensure that they were acclimated to the environment, and the mice were stroked for 1-2 min to reduce non-specific stress stimulation. Each mouse was gently and quickly placed in the central area with their backs to the experimenter, and the experimenter immediately left. The SMART3.0 digital tracking system (Panlab, USA) automatically recorded the movements of mice in the arena. The exploring time of each mouse was 15 min, and the proportion of time spent in the central area was measured.
5.7 Morris water maze test
The Morris Water Maze (MWM) test is a classical behavioral task to test hippocampal-dependent learning and memory of mice, consisting of 5 days of learning phase and 1 day of probe phase. Room and water temperature were maintained at 22°C. A circular tank (120 cm diameter, 50 cm height) was divided into four quadrants with distinctive landmarks as visual cues, and equipped with a hidden platform (8 cm diameter, -1cm below the water surface). Before the test, the platform was lifted 1cm above the water surface, and the mouse was released to swim freely at the furthest site from the platform. The swimming speeds were recorded by the equipped SMART 3.0 Video Tracking System (Panlab, USA). Every day during learning phase, the mouse was released from each quadrant and swam for 60 s. Once the mouse found the platform within 60 s and stayed on it for 3 s, the system automatically recorded this period as escape latency. If the mouse did not find the platform within the 60 s, the system recorded escape latency as 60 s. The experimenter guided the mouse to the platform and allowed it to stay there for 10 s. On the sixth day, the platform was removed, the mouse was released at the furthest site from the platform and allowed to freely explore for 60 s. During probe phase, the swimming paths, the time spent in target quadrant, and the numbers of mice crossing the platform location were also recorded.
5.8 Western blotting
Mouse hippocampal tissues were harvested, cut with ophthalmic scissors, and lysed with RIPA lysis buffer and Phenylmethylsulphonyl fluoride (PMSF) (Solarbio LIFE SCIENCES, P0100). The proteins were separated by 10-12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane (Merck, Ireland). Then, the membranes were blocked with 5% non-fat milk for 1 h at room temperature and incubated with primary antibodies overnight at 4°C. The primary antibodies included SIRT1 Polyclonal antibody (Proteintech, 13161-1-AP), Phospho-Tau (Ser396) Recombinant Polyclonal Antibody (5HCLC) (Invitrogen, 710298), PSD95-Specific, DLG4 Polyclonal Antibody (Proteintech, 20665) and Recombinant Anti-Synaptophysin antibody (Abcam, ab32127). After washing three times with PBST, the membranes were incubated with Goat Anti-Rabbit IgG H&L (HRP) (Abcam, ab205718) for 1 h at room temperature. β-Tubulin and GAPDH were used as internal controls. After washing three times with PBST, immunoreactive bands were visualized using enhanced chemi-luminescence (ECL) (NCM Biotech, P10300) detection regent, and the film was taken by a ChemiDoc XRS+ System (Biorad, USA). The densitometric analysis of band intensities was carried out using the Image J software (National Institutes of Health, Bethesda, MD, USA).
5.9 Statistical analysis
All data were analyzed with SPSS R23.0.0.0 software. Data were expressed as mean ± standard error (SEM). Statistical comparisons between experimental group and control group or sham group were performed by using two-tailed unpaired Student's test. p < 0.05 was considered statistically significant.