Bacterial sample
A total of 198 consecutive, non-duplicates, Escherichia coli isolates were selected for the study. These isolates were collected from clinical samples obtained from Silchar Medical College and Hospital, Silchar, India between June 2014 and May 2015. E. coli isolates were selected based on their non-susceptibility to at least one of the carbapenem andE. coli ATCC 25922 was used as the quality control strain.
Transcriptional expression of AcrAB-TolC and ompF
To analyse the expressional level of efflux pump genes acrA and acrB in multidrug resistant clinical isolates of Escherichia coli quantitative Real Time PCR was performed. For Real Time PCR, total cellular RNA was isolated using the Qiagen Rneasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. cDNA was prepared by using Qiagen Reverse Transcription Kit (QIAGEN, Germany) and was quantified by Picodrop (Pico200, Cambridge, UK). Further, Real Time PCR amplification was performed using power Sybrgreen PCR master mix reagents kit (Applied Biosystems, Austin, USA) and the expression levels of acrA and acrB were assessed using StepOnePlus quantitative Real Time-PCR (Applied Biosystems, USA) using oligonucleotide primers [acrA(F): 5’CTCTCAGGCAGCTTAGCCCTAA3’, acrA(R): 5’TGCAGAGGTTCAGTTTTGACTGTT3’)] (15), [acrB(F): 5’AGCTTCCTGATGGTTGTCGG3’, acrB(R): 5’ACGGCTGATGGCATCTTTCA3’, [Omp F (F):5’AAGTAGTAGGTTGCGCCCAC3’, OmpF (R): 5’AGTTCGATTTCGGTCTGCGT3’]. The experiment was performed by using a house keeping gene RpslE as an internal control and the relative Ct value of the target genes were compared with that of the control E. coli ATCC 25922 to determine the fold change in the expressional level of mRNA of the test isolates. Each sample was processed in triplicates.
Transcriptional expression of marA, soxS and rob
Isolates with over expressed AcrAB-TolC were selected for this experiment and total RNA was isolated using Qiagen RNase Mini Kit (Qiagen, Germany), reverse transcribed into cDNA by using QuantiTect® reverse transcription kit (Qiagen, Germany). Quantification of cDNA was done by Pico drop (Pico 200, Cambridge, UK) and quantitative real time PCR was performed using Power SYBR Green Master Mix (Applied Biosystems, Warrington, UK) in StepOnePlus Real Time PCR (Applied Biosystems, USA) using primers for amplification of marA, soxS and rob genes as listed in Supplementary Table 2. The house keeping gene rpseL of E. coli was used as an internal standard. andthe relative expression of the targeted genes was determined by ΔΔCt method. Expression analysis was carried out to measure the relative expression of the mRNA compared with that of E. coli ATCC 25922. Each sample was processed in triplicates.
Determination of Transcriptional expression of the local regulator acrR gene
Isolates over-expressing AcrAB and AcrADefflux pump systems were selected and the transcriptional expression of the local regulatory gene AcrR were demonstrated by quantitative Real Time PCR using primers (forward primer: 5′ACAAGAAGCGCAAGAAACGC3′ and reverse primer: 5′CCAGCGAGGTGGATGATACC3′).E. coli ATCC 25922 was used as a reference strain. Transcriptional response of AcrR against concentration gradient carbapenem stress was also analysed by Real time PCR assay.
Transcriptional response of marA, soxS and rob under concentration gradient carbapenem stress
To test the effect of carbapenems on global transcriptional regulators, E. coli isolates were exposed to sub-inhibitory concentrations of meropenem, ertapenem and imipenem ranging from 0.25µg/ml to 2µg/ml. RNA was extracted using an Qiagen RNase Mini Kit (Qiagen, Germany) followed by cDNA synthesis using QuantiTect® reverse transcription kit (Qiagen, Germany) as per manufacturer’s instructions. Quantitative Real Time PCR was performed with specific primers (Supplementary Table 2) as per described earlier. Each sample was processed in triplicates and their relative expression was compared with that of E. coli ATCC 25922.
Sequencing of marA, soxS and rob
To detect any mutation in regions known to be involved in the regulation marA, soxS, and rob was amplified by using primers (Supplementary Table 3). The PCR products were sequenced using Sanger’s method. Sequences were compared with those from the GenBank nucleotide database using the Basic Local Alignment Search Tool (http://www.ncbi.nlm.nih.gov).
Cloning of marA, soxS and rob
The global regulatory genes were amplified as mentioned earlier (Supplementary Table 3) for marA, soxS and rob. PCR amplification was performed using 50μl of total reaction volume. The PCR products were then confirmed by 1.0% (w/v) agarose gels and purified using the Qiaquick® Gel Extraction Kit (Hilden, Germany) and cloned into pGEM -T vector (Promega, Madison, USA). The resulting recombinant plasmids were transformed into E. coli DH5α by heat shock method for functional characterization. Antimicrobial susceptibility testing of the clones were done by Kirby Bauer disc diffusion method against carbapenem antibiotics i.e. meropenem (10µg), ertapenem (10µg) and imipenem (10µg). Minimum inhibitory concentration of the clones against carbapenems was determined via agar dilution method. The results were interpreted as per CLSI 2017 guidelines (30).
Statistical analysis
The differences in relative expression of efflux pump gene regulatory genes marA, soxS and rob was compared with that of the wild type strain (both under normal condition and under concentration gradient carbapenem stress) between samples were determined with the help of one-way ANOVA followed by Tukey-Kramer (Tukey’s W) multiple comparison test. Differences were considered statistically significant at both 5% and 1% level when p < 0.05. SPSS version 17.0 was used for statistical analysis.