Bioinformatics analysis
To study the expression and association of TIGAR, Calpain 1, and Calpain2 in HCC progression, tumor tissue and surrounding normal tissue were taken from patients with HCC (n = 13). Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted to assess mRNA levels of TIGAR, Calpain 1, Calpain 2, and NF-ĸB in hepatic tissues. Pearson's correlation coefficients (r) and linear regression were carried out to analyze expression correlation between TIGAR and Calpain 1, as well as TIGAR and Calpain2.
Isolation of primary HCC cells
Primary HCC cells were separated from tumor tissue according to previously reported methods (14, 15). Resected HCC specimens were sliced into 1 cm3sections, which were suspended in RPM11640 medium (Hyclone, Logan, UT, USA) containing 100 U/ml of penicillin and 100 µg/ml of streptomycin (Solarbio, Beijing, China). Tissue sections were digested into single cells by a collagenase/hyaluronidase solution (Thermo Fisher Scientific, Waltham, MA, USA) followed by 0.25% trypsin-EDTA at 37℃ for 2 h, then filtered using a 120 mesh sieve. The filtrate was centrifuged at 1000r/min for 10 min at 37℃. Primary HCC cells in the precipitate were further purified from stromal cells using a magnetic bead isolate system (Beijing Percans Oncology Research Co., Ltd.). In this study, 10 primary HCC cell lines were divided into low and High groups (n =5 per group), according to TIGAR mRNA levels assessed by RT-PCR.
Cell Culture and treatment
HepG2 (American Type Culture Collection (ATCC), Manassas, VA, USA) and SMMC7721 cells (ATCC) as well as primary HCC cells were suspended in DMEM (Hyclone) with 10% FBS (GIBCO) and 100 U/ml penicillin (Beijing Solarbio Science, China) until reaching 80% confluency at 37℃ under 5% CO2.
To study the involvement of Ca2+ in TIGAR-induced cancer cell proliferation, HepG2 cells were transfected with TIGAR and then exposed to 10 µM of NMDP (Shanghai yuanye Bio-technology Co., Ltd, access No. 100270). To study the involvement of [Ca2+]i in TIGAR-induced drug resistance, HepG2 or primary HCC cells with oeTIGAR were treated with 10 µM of NMDP plus either Epi 2.5 µg/mL, 5-FU 5 µg/mL, or DDP 1mg/L. Epi, 5-FU, and DDP were all purchased from Selleck (https://www.selleck.cn/) with catalog numbersS1223, S1209, and S1166, respectively.
Groups
The cell experiments were divided into four parts. Part 1 examined the effects of siTIGAR on HepG2 and SMMC7721 cells. The two cell lines were transfected with siTIGAR, cultured for 72 h, then harvested at 0, 24, 48, and 72 h after treatment. The proliferation of cells at each time point was tested by CCK-8 assay. The [Ca2+]i content was evaluated using flow cytometry, and the protein levels of Calpain1, Calpain 2, cleaved-caspase 3 (c-caspase 3), Bax, Bcl2, nuclear and cytoplasmic NF-κB, total NF-κB, proliferating cell nuclear antigen (PCNA), H3, and GAPDH were detected by western blot at 48 h after treatment. Furthermore, the rescue assays of siTIGAR in the events involved in HCC were administrated by treatment with oeTIGAR in HepG2 cells, and the above indices were detected.
Part 2 examined the effects of oeTIGAR on drug resistance (NMDP) of HepG2. The first step tested the expression of TIGAR in HepG2 cells after oeTIGAR. The HepG2 cells were treated with an empty vector (Vector) and oeTIGAR, and the cells treated with the same amount of medium were used as control (Control). The cells were harvested at 48 h after treatment and the expression of TIGAR was measured. The second step divided the HepG2 cells into four groups: Vector group, oeTIGAR group, empty Vector + NMDP treatment group, and oeTIGAR + NMDP treatment group. The cells were transfected with empty Vector or oeTIGAR, and NMDP (10 µM) was added to the groups at the same time. The cell samples were harvested at 0, 24, 48, and 72 h after treatment. The proliferation of cells at each time point was tested by CCK-8 assay. The [Ca2+]i content was evaluated using flow cytometry, and the protein levels of Calpain1, Calpain 2, nuclear NF-κB, cytoplasmic NF-κB, total NF-κB, PCNA, H3, and GAPDH were detected by western blot at 48 h after treatment.
Part 3 assessed the effects of oeTIGAR on drug resistance of HepG2 cells against NMDP (10 µM) plus Epi 2.5 µg/mL, 5-FU 5 µg/mL, or DDP 1 mg/L. The cells were divided into six groups: Vector, oeTIGAR, Vector + Epi, oeTIGAR + 5-FU, Vector + NMDP + DDP, and oeTIGAR + NMDP + drug. The cell samples were harvested at 0, 24, 48, and 72 h after treatment. The proliferation of cells at each time point was tested by CCK-8 assay. Further, the protein levels of PCNA and H3 were detected using western blot at 48 h after treatment.
In part 4, 10 primary HCC cell lines were divided into low (A1–A5) and High (B1–B5) groups, according to TIGAR mRNA levels assessed by RT-PCR. All cell lines were treated with anti-HCC drugs (Epi, 5-Fu, and DDP) with or without NMDP, and CCK-8 was used to assess proliferation of primary HCC at 48 h. In addition, we assessed the effects of siTIGAR on drug resistance of two higher TIGAR expression cell lines (B4 and B5 cells) against NMDP (10 µM) plus 5-FU or DDP. Each cell line was divided into six groups: siNC, siTIGAR, siNC + drug, siTIGAR + drug, siNC + NMDP + drug, and siTIGAR + NMDP + drug. The cell samples were harvested at 48 after treatment. The proliferation of cells at each time point was tested by CCK-8 assay, and the protein levels of PCNA and H3 were detected using western blot at 48 h after treatment.
Production and transfection of oeTIGAR vectors
The primers of the human TIGAR gene (NM_020375.3) are TIGAR-F: 5′ -CGGAATTCATGGCTCGCTTCGCTCTG-3′ and TIGAR-R: 5′-CGGGATCCTTAGCGAGTTTCAGTCAGTCCATTTAG-3′, which were implanted into pLVX-Puro vector (Clontech, Palo Alto, USA). After the DNA sequence of TIGAR in the pGEM-T vector was confirmed, the gene fragment was ligated into the pLVX-Puro transfer plasmid (Lenti-X™; Clontech Laboratories, Mountain View, CA, USA) and packaged into lentiviruses according to the manufacturer's proposal, and transfected into HCC cells using 293fectin™ transfection reagent (Invitrogen, Carlsbad, USA). Stably expressing Flag-TIGAR cell line was identified by RT-PCR and western blotting. Meanwhile, cells transfected with pLVX-Puro vector without TIGAR expression were the control.
TIGAR transfection and RNA interference
Two siRNA target TIGAR (siTIGAR-1 and siTIGAR-2) genes were chosen and transfected into HepG2 and SMMC7721, according to a previous study’s methods (8). siTIGAR-1 was used in the following experiments as siTIGAR.
Isolation of nuclear and cytoplasmic fractions
Cytoplasmic and nuclear protein extracts of HCC cells were separated through NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (#78835, Thermo Fisher Scientific, Waltham, MA, USA) according to a previously reported study (16).
Western blot
A total of 30 mg of cytoplasmic and nuclear proteins from HCC cells were quantified by BCA protein assay kit (PICPI23223, Thermo, IL, USA), then separated by SDS-PAGE. Electrophoretic pure containing TIGAR, Calpain 1, Calpain 2, nuclear NF-κB, and cytoplasmic NF-κB were transferred to PVDF membranes. After blocking in 5% skim milk for 1 h, the membrane was incubated with anti-TIGAR (Ab37910, Abcam Cambridge, MA, USA), anti-NF-ĸB antibody (Ab16502, Abcam), anti-Calpain 1 antibody (Ab108400, Abcam), anti-Calpain 2 antibody (Ab236650, Abcam), anti-GAPDH antibody (60004-1-1G, Proteintech, Wuhan, China), and anti-H3 antibody (#4499, Cell Signaling Technology, Danvers, MA, USA) at 4℃ overnight, followed by secondary antibodies (A0208 and A0216, Beyotime Biotechnology, Shanghai, China) for another 1 h. Immunoreactive bands for TIGAR, Calpain 1, Calpain 2, and nuclear and cytoplasmic NF-κB were analyzed by ECL system (GE Healthcare/Amersham Biosciences, Pittsburgh, PA, USA) with Image J software (NIH, Bethesda, USA). TIGAR, Calpain 1, Calpain 2, and cytoplasmic NF-κB were normalized using GAPDH while nuclear NF-κB was normalized using H3.
RT-PCR
Total RNA from HCC tissues or cell samples was extracted via Trizol regent (1596-026, Invitrogen, Carlsbad, CA, USA), and subjected to reverse transcription using Revert Aid First Stand cDNA Synthesis kit (Fermentas, USA). Quantified analysis of mRNA levels of TIGAR, Calpain1, Calpain2, NF-ĸB, and GAPDH were conducted using SYBR Green PCR Mix (Thermo, Shanghai, China) on ABI Prism 7300 SDS system (Applied Biosystem, Foster City, CA, USA). Primers used in RT-PCR are listed in Table 1.
Table 1
Primers used in RT-PCR analysis.
Gene | Primer (5’-3’) |
TIGAR (NM_020375.3) 460-600, 141 bps | Forward: TCCCAAGGATCTCCAAGC Reverse: AGCACCGTGACTCACAAC |
Calpain1 (NM_001198869.1) 1256-1525, 270 bps | Forward: TCGTGCTCGCCCTTATGC Reverse: AGTCGCCCTCCTTGTTGG |
Calpain2 (NM_001748.5) 331-515, 185 bps | Forward: ATTGCCTCCCTCACCTTG Reverse: TCGGCTGAATGCACAAAG |
NF-ĸB (NM_021975.4) 448-556, 109 bps | Forward: GGGGACTACGACCTGAATG Reverse: TGTCAAAGATGGGATGAGAAAG |
GAPDH (NM_002046.7) 25-241, 217 bps | Forward: GGATTGTCTGGCAGTAGCC Reverse: ATTGTGAAAGGCAGGGAG |
Cell counting kit-8 (CCK-8)
After culture of HCC cells (HepG2 and SMMC7721) or primary HCC cells (3×103 cells/well) within a stipulated time, CCK-8 reagent (10% v/v, obtained from CP002, SAB, https://www.sabbiotech.com/) was placed in each well for 1 h at 37℃, and absorbance (OD) at 450 nm was documented using a plate reader (Bio-Tek, Winooski, VT, USA).
Intracellular [Ca2+]i measurements
HCC cells were incubated with 10 µM of Fura 2-AM (F1241, Life Technologies, Carlsbad, CA, USA) for 1h at 37℃ under 5% CO2. [Ca2+]i content were evaluated using flow cytometry (Accuri C6, BD, Biosciences, USA) with Flowjo (Tree Star, Version 9.2, Ashland, OR, USA) software.
Statistical analysis
Data were calculated using Graphpad Prism 6 (GraphPad Software Inc., USA) and presented as mean ± SEM. Difference effect between groups was determined using one-way ANOVA with Tukey–Kramer method, and P value < 0.05 being significant. Correlations between TIGAR and Calpain1, as well as TIGAR and Calpain2 in HCC tumor samples were assessed by Pearson r analysis.