Animals and treatments
Forty-eight female MRL/lpr mice (weighing 25.5 ± 3.0g at 8 weeks old) were purchased from Shanghai Laboratory Animal Center of the Chinese Academy of Sciences (Shanghai, China) and the quality certificate number: SCXK hu 2017-0005. All experiments were performed according to the institutional ethical guidelines on animal care and approved by the Institute Animal Care and Use Committee at the Weifang Medical University, Shandong, China. The mice were maintained under specific pathogen-free (SPF) conditions with free access to standard diet and tap water, and kept in a controlled temperature (20-24 °C) and humidity (50-55%) environment with a 12h light-dark cycle. All the mice were acclimatized to the environment for 2 weeks prior to the experiments.
At the age of 11 weeks, forty-eight MRL/lpr mice were randomly divided into 8 groups with 6 mice per group: the VitD3-treated groups and control groups. Mice in the VitD3-treated groups received 4μg/kg 1,25-dihydroxyvitamin D3(Sigma-Aldrich Co., St. Louis, MO, USA) in 1% dimethyl sulfoxide (DMSO, Sigma-Aldrich Co., St. Louis, MO, USA)intraperitoneal injection twice a week for 3 weeks (mice were executed at 0,2,4,6 weeks after treatment); mice in the control groups received 1%DMSO intraperitoneal injections for 3 weeks (mice were executed at 0,2,4,6 weeks after injections). Then, the animals were weighed and anesthetized under 1% pentobarbital (35 ml/kg i.p.), and the blood and kidney samples were collected respectively at planned intervals (Fig.1).
Histological and immunohistochemistry analysis
The kidney samples were fixed in 4% paraformaldehyde solution and embedded in paraffin, sectioned into 5-μm slices. Hematoxylin and eosin (HE) and Masson's trichrome stains were used for histological analysis. After deparaffinization, antigen retrieval, blocking by 3% H2O2 and 10% goat serum, antibodies against C3 (Proteintech, Inc. China) were used for immunohistochemistry staining. After the secondary antibody was incubated with biotin streptavidin HRP conjugate, the antibody staining color was displayed with DAB substrate solution. Besides, immunofluorescence detections of IgG and IgM in the kidney were implemented using fluorescent-dye conjugated antibodies against mouse IgG (Abcam, Cambridge, MA) and mouse IgM mu chain (Abcam, Cambridge, MA). All the images were obtained through a microscope equipped with a color camera (Nikon Eclipse Ni, Japan).
Enzyme linked immunosorbent assay (ELISA) analysis
Serum samples were acquired from whole blood by centrifugation (4℃, 4000r, 10 min) and stored at −80℃ to avoid freeze-thaw cycles for further examinations. Following the manufacturer's protocols, the levels of serum, A-ds DNA, C3, TNF-α and IL-17 were detected by ELISA (Wuhan Boster Bio-engineering Co. Ltd., Wuhan, China).
Western blotting analysis
Total protein was extracted from kidney samples in RIPA lysing buffer (Thermo Fischer Scientific, Inc. Waltham, MA). And after BCA protein assay kit (Pierce, USA), the protein samples were mixed with loading buffer and boiled for 5 minutes. Then the protein samples were separated on electrophoresis gels and transferred onto PVDF membranes (Millipore, Bedford, MA, USA). The membranes were incubated with the following antibodies overnight at 4℃ under agitation: NF-κBp65(1:1000, Cell Signaling Technology, USA), p-NF-κBp65(1:1000, Cell Signaling Technology, USA), IKBα(1:1000, Abcam, UK),p-IKBα(1:1000, Abcam, UK), IKKα/β (1:1000, Abcam, UK), p-IKKα/β(1:1000, Cell Signaling Technology, USA), ERK1/2 (1:1000, Cell Signaling Technology, USA), p-ERK1/2 (1:1000, Cell Signaling Technology, USA), JNK(1:1000, Abcam, UK), p-JNK(1:1000, Cell Signaling Technology, USA), p38(1:1000, Cell Signaling Technology, USA), p-p38(1:1000, Cell Signaling Technology, USA) and GAPDH (1:10,000, Abcam, UK), followed by incubation with the horseradish peroxidase-conjugated secondary antibody for 2h at room temperature under agitation. After ECL Detection Kit, the protein blots were collected and measured with ImageJ software.
Real-time quantitative PCR analysis
Total RNA was isolated from kidney samples by Trizol reagent (Takara Biotechnology, Dalian, China). The cDNA was generated by using reverse transcription-polymerase chain reaction (RT-PCR) kit (Takara Biotechnology, Dalian, China) following the manufacturer’s protocols. RT-PCR was carried out for NF-κBp65, p38, ERK1, JNK, and GAPDH using LightCycler480 II (Roche). The levels of genes expression were analyzed by the equation 2 -(∆∆Ct). PCR primer sequences were listed in Table 1.
Table1. Primer sequences used in the study. (Primer Premier 5.0)
Genes
|
Forward primers (5′–3′)
|
Reverse primers (5′–3′)
|
NF-κBp65
p38
ERK1
JNK
GAPDH
|
CAGCATCCCTCAGCACCAT
GACCTAAAGCCCAGCAACCT
GCCTTCCAATCTGCTTATCAA
CAGTTTTACAGTGTGCAGGTGG
GGTTGTCTCCTGCGACTTCA
|
CCATGGCTGAGGAAGGGA
CAGCCCACGGACCAAATAT
GATTTGGTGTAGCCCTTGGA
CTTTGCGTGCGTTTGGTT
TGGTCCAGGGTTTCTTACTCC
|
Statistical analysis
Results were expressed as the mean ± standard deviation. SPSS statistical software (Version 20, SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Data were analyzed by t-test and one-way analysis of variance (ANOVA) and p < 0.05 was considered to be statistically significant.