Microorganisms and chemicals
The PrimeSTAR®MAX, pMD19-T vector, restriction enzymes and T4 DNA ligase were bought from Takara (Shanghai, China). 2-HAP was purchased from TCI Development Co., Ltd. (Shanghai, China). (R)-, (S)-PED, PED and NADPH were purchased from Sigma–Aldrich (Shanghai, China). Hexane and isopropanol of chromatographic grade used for high performance liquid chromatography (HPLC) were purchased from Sigma–Aldrich (Shanghai, China). All other chemicals used were of analytical grade and commercially available.
Escherichia coli JM109 (Invitrogen Co., Shanghai, China) was used as a host for plasmid propagation. E. coli BL21 (DE3) (Invitrogen Co., Shanghai, China) was used for protein expression. E. coli JM109 and E. coli BL21 were cultured at 37 oC in Luria–Bertani (LB) medium supplemented with kanamycin (50 μg/mL) as the selective marker. The strains and plasmids used in this work were summarized in Table 1.
Table 1. Bacterial strains, plasmids and primers used in this work.
Strains/plasmids/primers
|
Characteristics
|
Sources
|
Strains
|
|
|
E. coli JM109
|
Host gene cloning
|
Invitrogen
|
E. coli BL21(DE3)
|
Host of target gene for expression
|
Invitrogen
|
E. coli/pET-A258F/GDH
|
E. coli BL21 containing pET-A258F/GDH
|
[22]
|
E. coli/pET-SCRII
|
E. coli BL21 containing pET-SCRII
|
[23]
|
E. coli/pET-XYN2
|
E. coli BL21 containing pET-XYN2
|
This work
|
E. coli/pET-S-G-2
|
E. coli BL21 containing pET-S-G-2
|
This work
|
E. coli/pET-S-2-G
|
E. coli BL21 containing pET-S-2-G
|
This work
|
E. coli/pET-G-S-2
|
E. coli BL21 containing pET-G-S-2
|
This work
|
E. coli/pET-G-2-S
|
E. coli BL21 containing pET-G-2-S
|
This work
|
Plasmids
|
|
|
pET-A258F/GDH
|
A258F/GDH gene on pET-28a, 6.15 kb
|
This lab
|
pET-SCRII
|
SCRII gene on pET-28a, 6.21 kb
|
This lab
|
pET-XYN2
|
XYN2 gene on pET-28a, 6.04 kb
|
This work
|
pMD19-T
|
Cloning plasmid, 2.7 kb, Ampr
|
Takara Co.
|
T-S-G-2
|
S-G-2 gene on pMD19-T,4.97 kb
|
This work
|
T-S-2-G
|
S-2-G gene on pMD19-T, 4.97 kb
|
This work
|
T-G-S-2
|
G-S-2 gene on pMD19-T, 4.97 kb
|
This work
|
T-G-2-S
|
G-2-S gene on pMD19-T, 4.97 kb
|
This work
|
pET-S-G-2
|
S-G-2 gene on pET-28a 7.66 kb
|
This work
|
pET-S-2-G
|
S-2-G gene on pET-28a, 7.66 kb
|
This work
|
pET-G-S-2
|
G-S-2 gene on pET-28a, 7.66 kb
|
This work
|
pET-G-2-S
|
G-2-S gene on pET-28a, 7.66 kb
|
This work
|
Primers
|
Sequence (5’→3’)
|
|
SCRII-F1
|
GGATCCATGGGCGAAATCGAATCTTATTGCAA
|
SCRII-F2
|
TGGCCGCGGTGAAGGAGATATACCATGGGCGAAATCGAATCTTA
|
SCRII-F3
|
TACCGTGAGCGAAGGAGATATACCATGGGCGAAATCGAATCTTA
|
SCRII-R1
|
AACTCACCATGGTATATCTCCTTCTGGACAAGTGTAACCACCATCG
|
SCRII-R2
|
CCGGATACATGGTATATCTCCTTCTGGACAAGTGTAACCACCATCG
|
SCRII-R3
|
TGGTCTGCATGGTATATCTCCTTCTGGACAAGTGTAACCACCATCG
|
SCRII-R4
|
GAGCTCTGGACAAGTGTAACCACCATCG
|
A258F/GDH-F1
|
TACCGTGAGCGAAGGAGATATACCATGTATCCGGATTTAAAAGG
|
A258F/GDH-F2
|
CACTTGTCCAGAAGGAGATATACCATGTATCCGGATTTAAAAGG
|
A258F/GDH-F3
|
GGATCCATGTATCCGGATTTAAAAGG
|
A258F/GDH-R1
|
GAGCTCACCGCGGCCAAACTGGAATG
|
A258F/GDH-R2
|
TGGTCTGCATGGTATATCTCCTTCACCGCGGCCAAACTGGAATG
|
A258F/GDH-R3
|
TTTCGCCCATGGTATATCTCCTTCACCGCGGCCAAACTGGAATG
|
XYN2-F1
|
CACTTGTCCAGAAGGAGATATACCATGCAGACCATCCAGCCGGG
|
XYN2-F2
|
TGGCCGCGGTGAAGGAGATATACCATGCAGACCATCCAGCCGGG
|
XYN2-F3
|
CACTTGTCCAGAAGGAGATATACCATGCAGACCATCCAGCCGGG
|
XYN2-R1
|
CCGGATACATGGTATATCTCCTTCGCTCACGGTAATGCTGGCGC
|
XYN2-R2
|
TTTCGCCCATGGTATATCTCCTTCGCTCACGGTAATGCTGGCGC
|
XYN2-R3
|
GAGCTCGCTCACGGTAATGCTGGCGC
|
Notes: Apr: ampicillin resistance.
The sequence of SD-AS is bold; the restriction endonuclease sites are underlined.
Gene cloning of SCRII, A258F/GDH and XYN2
The oligonucleotide primers (Table 1) were designed based on the gene sequences. The genes SCRII, A258F/GDH and XYN2 were amplified using the plasmids pET-SCRII, pET-A258F/GDH and pET-XYN2 as the DNA template, respectively. The PCR-amplified products were ligated to pMD19-T (Takara-Bio, Kyoto, Japan) to obtain T-SCRII, T-A258F/GDH and T-XYN2 plasmids, which were transformed in E. coli JM109 cells and the recombinant strains were verified by DNA sequencing in Takara Co. (Shanghai, China).
Construction of co-expression system of SCRII, A258F/GDH and XYN2
Several multi-enzymes coupled systems containing the SCRII, XYN2 and A258F/GDH were constructed using a Shine–Dalgarno (SD) and aligned spacing (AS) sequence (GAAGGAGATATACC) linker between them. Either SCRII or A258F/GDH was nearest to the promoter. The fusion genes SCRII-SD-AS-A258F/GDH-SD-AS-XYN2 (named as S-G-2), SCRII-SD-AS-XYN2-SD-AS-A258F/GDH (named as S-2-G), A258F/GDH-SD-AS-SCRII-SD-AS-XYN2 (named as G-S-2), A258F/GDH-SD-AS-XYN2-SD-AS-SCRII (named as G-2-S), were cloned using overlap-extension technique. In each fusion gene, the leftmost genes were nearest the promoter. Then the four fusion genes were constructed on the plasmid pET-28a, and the plasmids, pET-S-G-2, pET-S-2-G, pET-G-S-2 and pET-G-2-S were transformed into the competent cells of E. coli BL21. The corresponding recombinant strains E. coli/pET-S-G-2, E. colipET-S-2-G, E. colipET-G-S-2 and E. colipET-G-2-S were obtained after the confirmation of nucleotide sequencing. Meanwhile, the plasmids, pET-SCRII, pET-A258F/GDH, and pET-XYN2 were transformed into the competent cells of E. coli BL21 to obtain recombinant E. coli/pET-SCRII, E. coli/pET-A258F/GDH and E. coli/pET-XYN2.
Protein expression
The recombinant strains E. coli/pET-S-2-G, E. coli/pET-S-G-2, E. coli/pET-G-2-S and E. coli/pET-G-S-2 were cultured in LB medium containing 50 μg/mL kanamycin at 37 oC. When OD600 value of the culture reached 0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) of 0.1 mM was added to induce protein expression. The cultures were cultivated at 25 oC for 16 h. The cultures were harvested by centrifugation, suspended in 50 mM Tris–HCl (pH 8.0) and 150 mM NaCl, and then disrupted with an ultrasonic oscillator (Insonater 201 M; Kubota, Japan). After centrifugation (10,000× g) for 30 min at 4 oC, the cell-free extracts were used for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis and the enzyme assays.
Enzyme assay
The specific activities of three enzymes, SCRII, A258F/GDH and XYN2 were determined using cell-free extracts of recombinant E. coli/pET-G-S-2, E. coli/pET-G-2-S, E. coli/pET-S-G-2 and E. coli/pET-S-2-G. Their enzyme activities were analyzed using 2-HAP, xylose and xylan as substrates, respectively.
The enzymatic activities of SCRII for oxidation of 2-HAP were measured at 35 oC and pH 6.5 mixture by spectrophotometrically recording the rate of change of NADPH absorbance at 340 nm. One unit of enzyme activity is defined as the amount of enzyme catalyzing the oxidation of 1 μmol of NADPH per minute under the measurement conditions. The standard assays were performed as described by Zhang et al [23].
The oxidation activities of A258F/GDH were measured at 35 oC and pH 7.0 by spectrophotometrically recording the rate of change of NADPH absorbance at 340 nm. One unit of enzyme activity is defined as the amount of enzyme catalyzing the reduction of 1 μmol of NADP+ per minute under the measurement conditions.
Xylanase activity was assayed by the method described by Bailey et al. with 1% oat-spelt xylan (Sigma) as substrate at 50 oC [31]. Appropriate dilutions of the protein solution in 0.1 M sodium citrate buffer (pH 6.0) were used as the enzyme source. The amount of released sugar was determined by the dinitrosalicylic acid method described by Miller et al. [32]. The protein concentration was determined by the Bradford method with bovine serum albumin as the standard.
The temperature optimum of enzymes activity was determined at various temperatures (20−80 oC). The pH optimum of enzyme activity was determined at the optimal temperature over a pH range of 3.0–10.0. The buffers used were 0.1 M sodium citrate buffer (pH 3.0 to 6.5), 0.1 M potassium phosphate buffer (pH 6.5 to 7.5), and 0.1 M Tris-HCl buffer (pH 8.0 to 10.0), respectively.
Biotransformation and analytical methods
The recombinant E. coli/pET-G-S-2 cells were used for 2-HAP biotransformation. The biotransformation was carried out as described previously with minor modifications [33]. The reaction mixture (2 mL) consisted of 0.1 M sodium citrate buffer (pH 6.5), 6 g/L 2-HAP, 6 g/L xylan, and 0.2 g washed wet cells (10% w/v). When the reaction was upscaled in 200 mL, the corresponding washed wet cells was 20 g, and the other components in the reaction mixture maintained the same concentration. The reactions were carried out at 35 oC for 24 h with shaking at 200 rpm, using the wet recombinant cells as biocatalysts. At the end of the reaction, the product (S)-PED was extracted with ethyl acetate, and the organic layer was used for analysis. The optical purity and yield of the product were determined by HPLC on a Chiralcel OB-H column (4.6 X 250 mm Daicel Chemical Ind. Ltd., Japan) with flow rate 0.5 mL/min at 25 oC. The retention times of (S)-PED and 2-HAP are 11.5 and 17.8 minutes, respectively.
pH and temperature dependence
The effects of pH and reaction temperature on 2-HAP biotransformation were determined by the whole cells of E. coli/pET-G-S-2. The biotransformation of 2-HAP to (S)-PED was carried out in pH 3.0–10.0 using 0.1 M sodium citrate (pH 3.0–6.5), 0.1 M potassium phosphate (pH 6.5–7.5), and 0.1 mM Tris-HCl (pH 8.0–10.0) as buffer. The temperature dependence of E. coli/pET-G-S-2 mediated 2-HAP transformation was determined at various temperatures ranging from 20 to 50 oC under the optimal pH. The biotransformation of 2-HAP was determined with the standard assay method described above.
Optimization of ratios of substrate and co-substrate
Under the optimal pH and temperature, the biotransformation was explored by E. coli/pET-G-S-2 with the ratios of 2-HAP and xylan varying from 5:1 to 1:5. The effects of the ratios on the efficiency of 2-HAP transformation were configured with 6 g/L 2-HAP and 1.2, 2.0, 3.0, 6.0, 12.0, 18.0 or 30.0 g/L xylan.