Patients and clinical characteristics.
Tumor samples were collected from forty-four patients with acromegaly who underwent endoscopic endonasal transsphenoidal surgery at the Department of Neurosurgery of Nanjing Jinling Hospital (Nanjing, China) between Nov. 2018 and Nov. 2019, including 21 males and 23 females. Additionally, 10 patients with clinically non‑functioning pituitary tumors (NFPA) were included as negative controls. Approval for the study was obtained from the Ethical Committee of Nanjing Jinling Hospital (2018NZKY-008-02) and informed consents were obtained from all the patients who participated in this study. Pituitary adenomas were classified into invasive and non-invasive tumors, according to the degree of lateral extension to the cavernous sinus (CS) space by MRI scanning (Cottier et al., 2000). Knosp grade 3 and 4 were defined as invasive pituitary adenomas, and Knosp grade 0 to 2 were defined as non-invasive tumors, respectively (Knosp et al., 1993). Tumor volume was determined by (length x width x height x Π)/6. The clinical characteristics of patients were described in Table 1.
Table 1 Comparison of clinical characteristics of patients with and without GNAS mutations
Detection of mutations in the GNAS gene
Genomic DNA was extracted from 44 GHPA and 10 NFPA tissues using a DNA miniprep kit according to the manufacturer's protocol (Qiagen GmbH, Hilden, Germany). The underlying point mutations in the GNAS gene have been reported in tumor specimens were CGT-to-TGT mutation at codon 201 (Arg201Cys) and CAG-to-CTG mutation at codon 227 (Gln227Leu) (Goto et al., 2014). PCR amplification of codon 201 and 227 was performed using a Taq DNAPolymerase (TTH Biotools Madrid, Spain) as previously described (Goto et al., 2014). The PCR products were purified by a PCR purification kit (Qiagen GmbH), and then directly sequenced by an ABI3730XL analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Carlsbad, USA). The primer sequences from PCR and DNA sequencing were listed in Table 2.
Table 2 The primer sequences of PCR and DNA sequencing
Gene
|
Primer sequences
|
GNAS codon 227
|
F: ATCATGGTTTCTTGACATTCACCCC
|
|
R: CCACCACGAAGATGATGGCAGTC
|
GNAS codon 201
|
F: CAAGCAGGCTGACTATGTGCCGA
|
|
R: GCTGGCCACCCACGTCAAAC
|
MEG3
|
F: ATCATCCGTCCACCTCCTTGTCTTC
|
|
R: GTATGAGCATAGCAAAGGTCAGGGC
|
β-actin
|
F: CACCCAGCACAATGAAGATCAAGAT
|
|
R: CCAGTTTTTAAATCCTGAGTCAAGC
|
Cell culture and transduction
GH3, a rat GH-secreting pituitary tumor cell line, which produces both growth hormone and prolactin, was purchased from the Cell Culture Centre, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (Beijing, China). GH3 cells were cultured in Ham’s F12 medium supplemented with 10% FBS and 1% streptomycin and penicillin in a humidified 5% CO2 incubator at 37°C.
A pWPT lentiviral expression vector was used to clone the wild-type or mutant-type GNAS gene and the generated construct was termed as follows: pWPT-GNAS (expressing GNAS wild-type), pWPT-GNAS-Q227L (expressing the mutated GNAS at Q227L), and pWPT-GNAS-R201C (expressing the mutated GNAS at R201C), respectively. GH3 cells were plated in 6-well plates at 70% confluence and then injected with lentivirus to express the wild-type or mutant-type GNAS. In addition, GH3 cells were transfected with a siRNA targeting MEG3 or a MEG3 cDNA with GFP- and Flag-tags and followed by puromycin selection for the generation of stable cell clones.
RNA extraction and quantitative reverse transcription PCR (RT-qPCR)
Total RNAs were isolated from tissues or cells using Trizol reagent and reverse transcribed into complementary DNA (cDNA) using the TaqMan MicroRNA Reverse Transcription Kit (TaKaRa, Dalian, China). RT-qPCR was performed using an SYBR Green PCR Master Mix (Takara, Japan) according to the manufacturer’s instructions. The sequences of qPCR primers were listed in Table 2. The lncRNA MEG3 was normalized by β-actin and the level of MEG3 in GHPA was further normalized by its level in NFPA.
RNA-seq
Total RNA was qualified by Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and the next-generation sequencing library was prepared according to the protocol provided by the manufacturer (NEBNext® Ultra™ RNA Library Prep Kit for Illumina® HiSeq system). The sequences and data analysis were performed by Genewiz, China.
Western blots
Proteins were extracted from tumor cells and tissues within RIPA buffer (Beyotime Biotech., Shanghai, China), and separated in SDS-Page gels and transferred onto polyvinylidene fluoride membranes. After blocking with 5% fat-free milk in a Tris-buffered saline with 0.1% Tween 20, the membranes were incubated at 4°C overnight with the primary antibodies against MMP-2, β-catenin, MMP-9, and β-actin, which were purchased from Cell Signaling Tech., Danvers, MA, USA). Subsequently, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Cell Signaling Tech.). The images were visualized using enhanced chemiluminescence (Beyotime). Pierce ECL Western Blotting Substrate (Thermo Scientific) was used to detect the chemiluminescence signals. Densitometric analyses of the western blot bands were performed using the Bio-Rad Imaging system (Bio-Rad, Hercules, California, USA).
Transwell assay
Matrigel matrix diluent (300 µg/mL) was used to coat the bottom of the upper chamber of the Transwell chamber and in a pre-cooled environment at 4℃. The volume ratio of serum-free F12 medium to matrigel in the upper chamber was 4:1, the total volume was 100µl, and the matrigel was frozen overnight at 4℃. The next day, 500 µl of F12 medium containing 10% FBS was added into the lower chamber. Cells (1×105) were seeded in the upper chamber. After incubation for 48h, non-invading cells in the upper chamber were removed. Cells that invaded the bottom chamber were fixed with 4% paraformaldehyde and stained using 0.1% crystal violet (Beyotime). Five random fields were selected for counting purposes under a microscope (magnification, ×200).
Immunofluorescence
Tumor tissue sections from surgical resection of GHPA. Tissue slides were fixed with 4% formaldehyde, blocked using 10% normal goat serum. Primary antibodies against β-catenin, E-cadherin, N-cadherin, Vimentin were diluted at 1:100 in PBS and added to the slides. All the antibodies were obtained from Cell Signaling Technology. After incubation overnight at 4˚C. After removal from the incubation chamber, slides were washed thrice with PBST. Then sections were incubated for 40 minutes in the dark in a humidified chamber at room temperature with goat polyclonal secondary antibody to rabbit IgG (1:300; Abcam Biotechnology, USA) reconstituted in PBS. Sections were washed three times with PBST. After the counterstaining procedure, sections were treated with glycerol/PBS (2:1) for 10 minutes in the dark at room temperature. counted in five randomly chosen fields using an Axiovert 200 fluorescent microscope.
Subcutaneous xenografts in nude mice
The animal experiments were approved by the Animal Experimentation Ethics Committee of the Jinling Hospital of Nanjing University.
Four-week-old female athymic BALB/c nude mice were purchased from the Shanghai SLAC Laboratory Animal Co. Ltd (Shanghai, China) and were housed and maintained in laminar airflow chambers under specific pathogen-free conditions. GH3 cells with different levels of MEG3 (107 cells/0.1ml) were subcutaneously injected into the right back side of mice. One week after the injection. After the tumor formed, lithium chloride (60 mg/kg/d in 100 µl saline), a β-catenin activator, was administered daily by intraperitoneal injecting in the group with the high levels of MEG3. The other groups were injected with saline alone as the controls. Tumor volumes were measured with a vernier caliper twice a week and calculated as (length × width2)/2. Four weeks after injection, the mice were sacrificed by cervical dislocation, and dissected tumors were weighed and processed to determine the expression levels of the relative proteins, including β-catenin, E-cadherin, N-cadherin, MMP-2, MMP-9.
Immunohistochemistry (IHC)
Tumor tissues from mice were fixed and antigens were exposed via heat-induced epitope retrieval with exposure to citric acid buffer (pH=7.0), blocked in 10% normal goat serum, and incubated with 3% hydrogen peroxide. The tissue slides were incubated with the primary antibodies against β-catenin (1:200), E-cadherin (1:200), N-cadherin (1:200), MMP-2 (1:200), MMP-9 (1:200) overnight at 4˚C, and then followed by incubated with a goat anti‑rabbit secondary antibody (Beyotime) for 15 min at 37˚C. The number of the positive cells was subsequently counted in each section in 10 random microscope fields (magnification, x200).
Statistical analysis
Statistical data analysis was done using SPSS 19.0. The Student's unpaired T-test and Fisher's exact test were used for intergroup analysis. The results were presented as mean ± standard deviation and the correlation was analyzed using a Spearman's correlation. P<0.05 was considered as statistical significance.