Ethics Statement
The study was conducted in accordance with the National Institutes of Health guidelines on the ethical use of animals. All experiments were performed with the approval of the Ethics Committee of Sun Yat-sen University. The experimental rats were purchased from the Laboratory Animal Center of Southern Medical University (License No: SCXK [Yue] 20160041).
Isolation, culture and identification of rDFCs
Sprague-Dawley rats (postnatal 5-7 days) were euthanatized by pentobarbital sodium and bathed in 75% ethanol for 10 min. rDFCs were carefully isolated from the tooth germs of the first and second mandibular molars of each rat and were cultured in α‐modified Eagle's medium (Gibco, Guangzhou, China) supplemented with 20% fetal bovine serum (FBS) (Gibco, Guangzhou, China) and 1% penicillin/streptomycin (Gibco, Guangzhou, China). rDFCs were incubated under 5% CO2 at 37℃. The medium was changed every 3 days until the cells reached ~80% confluence. Flow cytometry (FCM) was used to identify rDFCs with anti-CD29, CD34, CD44, CD45 and CD90 (1:200; Abcam Inc.).
Sanger Sequencing and Agarose gel Electrophoresis
According to the circRNA circularization site, specific divergent primers were designed. Sanger sequencing were carried out on the amplified products of divergent primers. Total RNA of rDFCs was extracted by Trizol reagent with or without RNaseR to obtain cDNA through inverse transcription of arbitrary primers. Then, cDNA was amplified by convergent primers and divergent primers. Agarose gel electrophoresis of the PCR product was carried out.
Fluorescence in situ Hybridization (FISH)
The probe labeled with CY3 were constructed for the circFgfr2 sequence and used for in situ hybridization. rDFCs were fixed with 4% paraformaldehyde for 5 min at 4 °C, treated with 0.5% Triton X-100 15 min at room temperature, incubated with 100% alcohol for 1 min. Dehydration and air drying. The probe was prepared and the hybridization buffer with the probe was denatured at 88 °C for 5 min. After hybridization, the slide was washed with 2×SSC, 5 min, at 42 °C and then 2×SSC was washed at room temperature, 5 min×2. Inhale 50 µL DAPI-Antifade solution on the slide, cover the slide and incubate at dark room temperature for 20 min. Observation under fluorescence microscope.
Cell transfection
The full-length cDNA of circFgfr2 was amplified from rDFCs cloned into the specific vector pLC5-ciR (Geneseed, Guangzhou) between the BamHI and EcoRI sites for circFgfr2 over-expression (pLC5-ciR-circFgfr2). The mock plasmid pLC5-ciR (NC) without the circFgfr2 cDNA served as a control. Immunofluorescence was carried out for the verification of transfection according to the manufacturer’s instructions. To over-express miR-133a-3p, miR-133a-3p mimics and NC-mimics were purchased from ThermoFisher. The rDFCs were transfected with the above plasmids and mimics according to the requirements of each experiment by using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. After 48h, the rDFCs were harvested and used for further research.
RNA high-throughput sequencing
Total RNA was extracted from rDFCs of the circFgfr2 overexpression group and control groups. Then, the messenger RNA was purified by polyA selection, chemically fragmented and converted into single-stranded cDNA via random hexamer priming. After that, the second strand is generated to create double-stranded cDNA. TruSeq libraries were prepared using TruSeq DNA Library Preparation Kits (illumina, San Diego, CA) following with quality control using software Fastp (Shenzhen, China). During quality control, the sequence of the joint and the three bases at the beginning and end were removed. Then, 4bp width window was used to retrieve the sequencing read segments, and the base quality lower than Q30 was removed. Finally, the read segment with at least 50bp length is selected for the downstream analysis process. The data after quality control was compared to the Rat genome (HISAT2 index: Ensembl rnor_6.0 Genome_TRAN) using software HISAT2 V.2.0.5 (https://ccb.jhu.edu/software/hisat2/index.shtml). The result (BAM format file) is then compared and sorted by chromosome position. Through StringTie V.1.3.3b software (http://ccb.jhu.edu/software/stringtie/), we detected and quantified the known protein encoding gene transcripts. Differentially expressed genes were analyzed using edgeR software (https://bioconductor.org/packages/release/bioc/html/edgeR.html). Firstly, the relative expression level was generated according to the original count of the gene, and the unit was CPM (Counts Per Million). Then differentially expressed genes were were calculated and considered statistically significant when P-value<0.05 and |log(FC)|≧1. Metascape gene annotation and analysis resource (https://metascape.org/gp/#/main/step1), the Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) and Cytoscape V3.6.0 software (The Cytoscape Consortium, San Diego, CA) were used for gene annotation, enrichment and pathway analysis.
Real-time quantitative polymerase chain reaction (qRT-PCR)
Total RNA was extracted through Trizol reagent (Invitrogen). Total RNA was reverse transcribed to cDNA using Geneseed® II First Strand cDNA Synthesis Kit (Geneseed, China). Relative mRNA and miRNA expression levels were detected by qRT-PCR using Geneseed® qPCR SYBR® Green Master Mix (Geneseed, China). GAPDH or U6 was used as an internal control. All reactions were run in triplicates and fold expression changes calculated via the comparative 2–∆∆Ct method. Table 1 lists PCR primers used in this study. Primers were synthesized by Forevergen Co, Ltd (Guangzhou, China).
TABLE 1
The primers used in this study.
Gene name
|
Forward (5'-3')
|
Reverse (5'-3')
|
circFgfr2
|
GTCCCATCAGACAAAGGCA
|
GCAGGGACAGCATGGAG
|
miR-133a-3p
|
CCTTTGGTCCCCTTCA
|
TGGTGTCGTGGAGTCG
|
miR-133a-5p
|
GCCGAGAGCTGGTAAAATGG
|
TGGTGTCGTGGAGTCG
|
RUNX2
|
AACCAAGTGGCCAGGTTCAA
|
GGATGAGGAATGCGCCCTAA
|
OCN
|
AGCTCAACCCCAATTGTGAC
|
AGCTGTGCCGTCCATACTTT
|
Osterix
|
GTCCTGGCAACACTCCTACC
|
GGGCAAAGTCAGACGGGTAA
|
BMP-2
|
CCAGCTGACACTTTAATATTTCCCA
|
TGTGCTGGAGTTGAACCCATA
|
BMP-6
|
GGAGATCCTGTCGGTGTTGG
|
GATCCAGCATGAAGAGCGGA
|
DLX3
|
GCCTCACACAAACACAGGTGA
|
GTGGTACCAGGAGTTGGTGG
|
GAPDH
|
TCCATGGCACCGTCAAG
|
CAGCCTTCTCCATGGTGG
|
U6
|
CTCGCTTCGGCAGCACA
|
AACGCTTCACGAATTTGCGT
|
CircRNA Analysis and Target Prediction
The genomic loci of the FGFR2 gene and circFgfr2 were analyzed by NCBI database (https://www.ncbi.nlm.nih.gov/). The binding sites of miRNAs with circFgfr2 were predicted by RegRNA 2.0 (http://regrna2.mbc.nctu.edu.tw/). Downstream genes of miRNAs were predicted by miRDB (http://mirdb.org/index.html), Targetscan (http://www.targetscan.org/vert_71/), and microT-CDS (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/index) databases.
Dual-luciferase reporter assay
PsiCHECK2.0 dual luciferase reporter vector containing wide type (WT) circFgfr2 (circFgfr2 WT) and WT DLX3 3’UTR (DLX3 WT) along with their mutant forms (circFgfr2 MUT 1, circFgfr2 MUT 2, circFgfr2 MUT 3 and DLX3 MUT, respectively), was constructed by Geneseed (Guangzhou, China). To determine whether miR-133a-5p directly targets circFgfr2, 293T cells were co-transfected with circFgfr2 WT or circFgfr2 MUT 1 together with miR-133a-5p mimics or NC. To determine whether miR-133a-3p directly targets circFgfr2, 293T cells were co-transfected with circFgfr2 WT or circFgfr2 MUT 2 or/and circFgfr2 MUT 3 together with miR-133a-3p mimics or NC. In order to verify the interaction between miR-133a-3p and DLX3 gene, another method of Dual-Luciferase reporter assay was employed. DLX3 WT or DLX3 MUT was co-transfected with miR-133a-3p mimics and NC mimics into 293T cells.
48h after the co-transfection, luciferase activity was measured via Dual-Glo@Luciferase Assay System E2940 (Promega, USA) according to the manufacturer’s instructions. Firefly luciferase activities were normalized to Renilla luminescence in each well. All the experiments were independently repeated three times.
Chromatin Isolation by RNA Purification (ChIRP)
circFgfr2 anti-sense DNA probes with biotin labeling at 3-prime end were designed and produced by Geneseed Biotech (Guangzhou, China): 1.GTGCTCCAACAACATCAAGG-Bio; 2.GTACGGTGCTCCAACAACAT-Bio. ChIRP analysis was performed according to protocols published by Chu et al[22]. LacZ probes were used as a non-specific probe. Total RNA was collected, and qRT-PCR was performed to confirm circFgfr2 probes and interaction of circFgfr2 with miR-133a-3p and miR-133a-5p.
Alkaline phosphatase activity detection and staining
ALP activity was assessed using AKP/ALP test kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to manufacturer’s protocol. Briefly, cells were seeded in 96-well plates, cell lysates were collected, samples were incubated at room temperature for 5-10 min, and dilution buffer was added to 100 µL of the sample in a 96-well plate. Finally, fluorescence was measured at OD 405 nm. rDFCs were fixed in 4% paraformaldehyde for 10 min, and then ALP staining was performed by ALP staining kit (Beyotime, Shanghai, China) according to the manufacturer’s protocol.
Alizarin red staining
RDFCs were washed twice with PBS and fixed with 4% paraformaldehyde for 10 min, and then stained with Alizarin red staining solution (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) for 30 min at room temperature.
Western blot analysis
Radioimmunoprecipitation assay lysis buffer (Fude, China) was used to extract proteins from cells. Protein concentrations were measured using a BCA protein assay kit (Abcam, USA), according to manufacturer's protocols. Each sample (20 μg) was mixed with 5x loading buffer (Cell Signaling Technology, USA), and boiled for 10 min. After separation using SDS-PAGE and 4%-20% gradient gels, the proteins were transferred to 0.22 μm polyvinylidene difluoride membranes (Millipore, USA). The nonspecific binding sites were blocked with 5% (wt/vol) skim milk for 120 min. The membranes were incubated with the primary antibody of RUNX2 (1:1000, abcam, USA) at 4 ℃ overnight. Subsequently, the membranes were incubated with horseradish peroxidase AffiniPure goat anti-mouse IgG secondary antibody (Emarbio, Beijing, China) at room temperature for 1 h. An enhanced chemiluminescence kit (Millipore Corp, Bedford, MA) was used for imaging.
Statistical analysis
Results are presented as mean ± standard deviation. Statistical significance was determined using two-tailed t-test. All data were analyzed using Prism 7.04 (GraphPad Software, USA). P<0.05 was considered statistically significant.