Sample collection
This study was approved by the ethics committees of the Institute of Blood Transfusion, Chinese Academy of Medical Sciences (IBT). A total of 1864 donation blood samples were obtained randomly from Feb to Mar 2018 in Dali, China. All donor samples were tested for Alanine aminotransferase (ALT), HBsAg, anti-HCV, anti-HIV-1/2, and syphilis during routine donor screening. Questionnaires about demographic and donation characteristics were voluntarily filled in by the donors, including gender, age, race/ethnicity, education, occupation, donation times, and history of consumption of raw food such as beef, mutton or milk. Test samples were stored in -80℃ freezers at blood center until they were shipped in batches to IBT in dry ice type environments. Among 1864 individual donors, 67.86% were males, 55.79% were Han, 61.53% were middle school and below educated, 34.07% were farmers, 79.61% were married, 50.70% were first donors, 98.39% having no raw milk diet history, and 98.23% having no raw meat diet history (Additional file 1. Fig S1.).
Detection of Anti HEV-IgG, Anti HEV-IgM and HEV IgA antibodies
ELISAs for detection of anti-HEV antibodies were established by using HEV-like-particles (HEV-LPs) as the antigen, which was produced by recombinant baculoviruses [15]. Microplates (96-well) were coated with 200 ng/well HEV-LPs with 0.05 M carbonate-bicarbonate buffer (pH 9.6) at 4°C overnight and blocked with 100 µl 10% Non-fat milk (Sigma, China) at 37°C for 2 h. After washing with PBS-T three times, 100 µL of 1:200 diluted plasma samples were added and incubated at 37°C for 1 h. After five times washing, each well was supplemented with 100 µl of horseradish peroxidase (HRP)-conjugated goat anti-human IgG (1:20000 diluted) (Cappel, Durham, NC) or IgM (1:10000 diluted) (Bethyl, USA) or IgA (1:10000 diluted) (Bethyl, USA) antibody and incubated at 37°C for 1 h. Then the plates were washed four times with PBS-T, added 100 µl of TMB/H2O2 (Beyotime, Shanghai, China), and incubated at darkroom for 15 min at room temperature. The enzymatic reaction was stopped with 50 µl 0.3 M sulphuric acid and the optical density (OD) values were measured at 450 nm. A cut-off value was determined on the mean OD450nm value of the negative control (NC) by the formula: Cut-off = 2.1 * NCmean. Values of OD450nm < Cut-off indicated a negative sample and ≥ Cut-off indicated a positive sample. Ten plasma samples collecting from donors without a history of HEV infection were used as a negative control.
Detection of capsid antigen of HEV
HEV antigen was detected by a two-step incubation antibody-based sandwich ELISA kit (Wantai, Beijing, China). The procedure was carried out according to the manufacturer’s instruction. The cutoff values of the assay were statistically established as the mean optical density value of negative controls at 450-nm optical wavelength plus 0.12.
HEV-RNA detection
Nucleic acids were extracted from 200 µL of each sample using the Magen virus RNA kit (Shanghai, China), according to the instructions of the manufacturer. HEV RNA detection was accomplished by TaqMan® real-time fluorescence reverse transcription-polymerase chain reaction (RT-PCR). After extraction of viral RNA from 200 µl of serum by a viral DNA/RNA mini kit (Magen, Shanghai, China), 30 µl of diethylpyrocarbonate (DEPC)-treated water was added. For TaqMan® RT-PCR, the 20 µl reaction contained 4 µl of 5× QuantiTect Probe RT-PCR kit Master Mix (Magen, Shanghai, China), 0.2 µl of enzyme, 10 µl of RNA, and primers and probe at concentrations of 250 and 100 nM, respectively. The primers and probe were widely used in many reports for HEV four major genotypes based on the multiple sequence alignments of 27 sequences of the ORF3 region [16]. PCR was performed on a sequence detection system platform (ABI Prism 7500, Applied Biosystems) as follows: Reverse transcription was carried out at 50℃ for 5 min, followed by denaturation at 95℃, then 40 cycles of denaturation at 95℃ for 10 seconds and annealing and extension at 60℃ for 30 seconds. The TaqMan® assay detected as few as 5 genome equivalent (GE) copies of HEV plasmid DNA. The sequence of the plasmid is:
5’- GCAGACTATCGCTGATGGTAAGGCCCATTTTACAGAGACTGTTAAACCTGTGCTTGATCTTACAAATTCTATCGTACAGCGGATAGAATGAATAACATGTTTTGTGCATTGCCCATGGGGTCACCATGTGCCCTAGGGCTGTTCTGTTGCTGTTCTTCGTGCTTCTGCCTATGCTGCCCGCGCCACCGGCCGGCCAGCCGTCTGGCCGCCGTCGTGGGCGGCGCAGCGGCGGTACCGGCGGTGGTTTCTGGGGTGACAGGGTTGATTCTCAGCCCTTCGCCCTCCCCTATATTCATCCAACCAACCCCTTCGCCGCCGATGTCGTTTCACAATCCGGGGCTGGAGCTCGCCCTCGACAGCCGCCCCGCCCCCTTGGCTCCGCTTGGCGTGA-3’.
Statistical analysis
Chi-square test was used to assess the anti-HEV IgG, IgM, IgA positive rate by donor’s demographic, donation characteristics, and history of consumption of raw food. The multivariable logistic regression model was then fit to examine factors associated with anti-HEV positivity. The traditional principle was used to define HEV seroprevalence: results of anti-HEV IgG in combination with IgM, whatever anti-HEV IgG or IgM was positive, it was thought as HEV seropositive which was used in this study. The multivariable logistic regression model was fit to examine factors associated with HEV seroprevalence. All statistical analyses were performed using the statistical software package SPSS17.0 (SPSS Inc., Chicago, IL). A p-value of 0.05 or less was considered significant.