Materials
Glycol chitosan (~ 100 kDa) was purchased from Wako Chemical USA, Inc. (Richmond, VA). Glycidyl methacrylate, heparin sodium salt from porcine intestinal mucosa (heparin, ~ 18 kDa), and 1-ethyl-3-(3-dimethyl- aminopropyl)-carbodiimide (EDC) were supplied from Sigma Aldrich (St. Louis, MO). Recombinant human bone morphogenetic protein-2 was supplied from GenScript (Piscataway, NJ). Recombinant human matrix metallopeptidase-9 (MMP-9) was purchased from abcam (Cambridge, MA) and recombinant mouse noggin/Fc chimera (Noggin) was purchased from R&D Systems (Minneapolis, MN). Demineralized Bone Matrix (DBM; Demineralized Cortical Powder, 0.212–0.850 mm) was provided from MTF Biologics (Edison, NJ). Mouse bone marrow stromal cells (BMSCs, D1 ORL UVA, CRL-12424) was obtained from American Type Culture Collection (ATCC, Manassas, VA). All reagents were used without further purification.
Preparation of Heparinized Chitosan and Hydrogel-DBM composite
Visible-light inducible methacrylated glycol chitosan (MeGC) was prepared by the previously published methods[22, 39]. Heparin conjugated glycidyl methacyrlated chitosan (Hep-MeGC) was prepared by EDC activated reaction of heparin and MeGC. EDC solution was prepared as 23 mg in 1 mL distilled water and reacted with 8 mg of heparin for 30 min. Then, the reacted solution was mixed with 5 mL of 1% (w/v) MeGC in PBS for 16 h, dialyzed with 50 kDa tubes for 16 h and lyophilized. Hydrogel-DBM composites incorporated hydrogel and DBM in various weight ratio, 0, 0.5, 1, 2, and 4% (w/v), based on 2% (w/v) hydrogel concentration. All hydrogels were fabricated by 40 s irradiation of hydrogel prepolymer and 6 µM riboflavin initiator (100:0.5 volume ratio) under visible blue light (400–500 nm, 300 mW cm− 2) irradiation.
Characterization of Heparinized Chitosan and Hydrogel-DBM composite
Heparin conjugation was analyzed by 1H nuclear magnetic resonance spectroscopy (NMR) in D2O (Bruker ARX400 spectrometer). It was quantified by the integration of the peaks at 2.7–3.2 ppm (CHNHSO3−, CHOSO3−, CH2OSO3−) and compared with methacrylate peak at 5.6–6.1 ppm. The degree of heparin substitution was reported as 6.76%. Heparinized chitosan was also characterized by fourier transform infrared spectrophotometer (FTIR, Jasco 420) to verify the heparin conjugation. The incorporation of heparin over time was examined by toluidine blue (Sigma-Aldrich, MO) staining that the hydrogels were stained with 1% (w/v) toluidine blue in PBS and washed with PBS for 1 h.
Mechanical properties of composites were measured by compressive modulus and water content. The compressive modulus was evaluated by 1.6 mm diameter flat-ended indentation test via Instron Electro- Mechanical Testing Machines (Instron, Model 5564, Norwood, MA) using a Poisson’s ratio of 0.25[22, 39]. Water content was calculated by the following equation where Wwet and Wdryreferred wet and dry weight of hydrogels respectively.
Alkaline Phosphatase Staining And Activity
Bioactivity of BMP-2 and osteogenic efficacy of MeGC, Hep-MeGC, and composites were evaluated by alkaline phosphatase (ALP) staining and activity. First of all, 100 ng mL− 1 of rhBMP-2 was incubated in the presence of 10 µL of MeGC or Hep-MeGC under different stressed conditions of 37 oC for 7 days or 200 ng mL− 1 of MMP-9 for 16 h. Then, 100 ng mL− 1 of incubated rhBMP-2 was treated to BMSCs in osteogenic media (OM) including high glucose Dulbecco’s Modified Eagle’s Medium, 10% fetal bovine serum, 1% antibiotic-antimycotic, 10 mM ß-glycerophosphate, 50 mg mL− 1 L-ascorbic acid, and 100 nM dexamethasone for 4 days. Second, 100 ng mL− 1 of rhBMP-2 was incubated in the presence of 10 µL of MeGC or Hep-MeGC with noggin (0, 30, 100, and 300 ng mL− 1) for 4 days. After all the culture, BMSCs were fixed with 10% formalin and incubated in solution containing nitro blue tetrazolium, 5-bromo-4-chloro-3-in doxylphosphate, 100 mM Tris (pH 8.5), 50 mM MgCl2, and 100 mM NaCl for 3 h. ALP activity was evaluated by reading the value at 405 nm with p-nitrophenol phosphate method and normalized by total protein expression from BCA assay[23, 40].
Real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
The induced noggin expression by MeGC or Hep-MeGC and osteogenic efficacy of composites were examined by qRT-PCR. The RNAs were extracted from BMSCs by TRIzol (Invitrogen, CA) and RNeasy mini kit (Qiagen, CA), and then reverse-transcribed by SuperScript III kit (Invitrogen, CA). The cDNA products were amplified for 45 cycles with SYBR green in LightCycler 480 PCR system (Indianapolis, IN). The value was normalized with GAPDH expression and the primer sequences are: GAPDH (AGGTCGGTGTGAACGGATTTG and TGTAGACCATGTAGTTGAGGTCA), Noggin (GCCAGCACTATCTACACATCC and GCGTCTCGTCAGATCCTTCT), Runx2 (CGGTCTCCTTCCAGGATGGT and GCTTCCGTCAGCGTCAACA), ALP (GTTGCCAAGCTGGGAAGAACAC and CCCACCCCGCTATTCCAAAC), and OCN (GGGAGACAACAGGGAGGAAAC and CAGGCTTCCTGCCAGTACCT). All experiments were triplicated.
Proliferation Of Cells In Hydrogel-dbm Composite
The BMSCs were encapsulated in composites with concentration of 2 x 106 cells mL−1. The base hydrogels, MeGC and Hep-MeGC, were mixed with various DBM ratio, 0, 1, and 2% (w/v) in 2% (w/v) hydrogel. The BMSCs encapsulated in hydrogels were cultured in culture media for two weeks at 37 oC. The morphology of BMSCs were monitored by Live/Dead staining kit (Invitrogen, CA) at day 0, 7, and 14 and proliferative potential was measured by alamarBlue (Thermo Fisher Scientific, CA) assay at day 0, 1, 7, and 14. To investigate the further morphology change of cells near DBM, hydrogels at day 14 were fixed with 10% formalin for overnight, embedded in paraffin, and cut into 5 µm section. The sections were stained with hematoxylin and eosin (H&E) after deparaffinizing.
Osteogenic Differentiation of Cells in Hydrogel-DBM composite
The BMSCs encapsulated in composites were incubated in OM for 21 days to induce osteogenesis. The samples were collected at day 7 for ALP staining and activity test. At day 21, the mineral deposition in the samples were measured by alizarin red S staining after fixation. The hydrogels were incubated in 2% alizarin red S solution for 5 min and washed with PBS for overnight. All stained hydrogels were visualized by Olympus SZX16 stereo microscope. Calcium quantification was carried out by acetic acid extraction of alizarin red S stained hydrogels[41].
Statistical Analysis
All experiments were executed three times and represented as values with error bars which were the average and the standard deviation. One- or two-way analysis of variance with Tukey’s post hoc test was used for statistical analysis. A value of p < 0.05 was considered as significant.