Mapping of functional elements of the Fab-6 boundary involved in the regulation of the Abd-B hox gene in Drosophila melanogaster

doi:10.21203/rs.3.rs-121843/v1

PDF

Research Article

Mapping of functional elements of the Fab-6 boundary involved in the regulation of the Abd-B hox gene in Drosophila melanogaster

https://doi.org/10.21203/rs.3.rs-121843/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 18 Feb, 2021

Read the published version in Scientific Reports →

You are reading this latest preprint version

The autonomy of segment-specific regulatory domains in the Bithorax complex is conferred by boundary elements and associated Polycomb response elements (PREs). The Fab-6 boundary is located at the junction of the iab-5 and iab-6 domains. Previous studies mapped it to a nuclease hypersensitive region 1 (HS1), while the iab-6 PRE was mapped to a second hypersensitive region HS2 nearly 3 kb away. To analyze the role of HS1 and HS2 in boundary we generated deletions of HS1 or HS1 + HS2 that have attP site for boundary replacement experiments. The 1389 bp HS1 deletion can be rescued by a 529 bp core Fab-6 sequence that includes two CTCF sites. However, Fab-6 HS1 cannot rescue the HS1 + HS2 deletion or substitute for another BX-C boundary – Fab-7. For this it must be combined with a PRE, either Fab-7 HS3, or Fab-6 HS2. These findings suggest that the boundary function of Fab-6 HS1 must be bolstered by an element that has PRE activity.

Molecular Genetics

Laboratory Diagnostics

Structural Biology

CTCF

chromatin boundary

architectural proteins

PRE

bithorax

The Drosophila Bithorax complex (BX-C) has three homeotic genes, Ultrabithorax (Ubx), Abdominal-A (abd-A) and Abdominal-B (Abd-B), which are responsible for the specifying cell identity in the posterior parasegments/segments, PS5-14/T3-A9 ^1–3. In each of these parasegments, the pattern of expression of the relevant homeotic gene determines identity. This expression pattern is generated by a unique collection of tissue specific enhancers that are located in nine functionally autonomous cis-regulatory domains. Two of these domains, abx/bx and bxd/pbx, direct Ubx expression in PS5 (T3) and PS6 (A1). Three domains, iab-2, iab-3 and iab-4 control abd-A in PS7-9 (A2-4), respectively. Finally Abd-B expression in PS10-13 (A5-9) is controlled by four regulatory domains, iab-5, iab-6, iab-7 and iab-8,9 respectively^3,4 (Fig. 1A).

BX-C regulation is divided into two phases, initiation and maintenance. During the initiation phase, which takes place around the blastoderm stage, a combination of gap, pair-rule gene and maternally derived transcription factors establishes parasegment identity by interacting with special initiator elements in each regulatory domain^3,5,6. This interaction sets the activity state, either on or off, of the regulatory domains^3,7,8. The BX-C regulatory domains are activated sequentially along the anterior-posterior axis. For example, iab-5 is activated in PS10 and it directs Abd-B expression in this parasegment, while the remaining Abd-B regulatory domains iab-6 - iab-8,9 are off. In PS11, both iab-5 and iab-6 are activated; however, iab-6, which is closer to the Abd-B promoter, is responsible for regulating transcription. Again, the iab-7 and iab-8,9 are off.

Once the gap, pair-rule and maternal gene products disappear during gastrulation, regulation of BX-C switches to the maintenance phase. In this phase the on and off states of the regulatory domains are maintained by Trithorax (Trx) and Polycomb (PcG) group proteins, respectively^3,9. Trx and PcG family proteins are highly conserved and regulate enhancer and promoter activity mainly by introducing or removing histone modifications¹⁰. Special elements, called PREs (Polycomb Responsible Element) are responsible for recruiting these maintenance factors^11,12. Originally discovered in BX-C, PREs were subsequently found to control many other developmental genes¹⁰. PREs in flies map to large nucleosome free regions and have sites for a complex array of DNA binding protein^11,12. Included in this group are recognition motifs for the GAGA transcription factor, GAF, and the one known PcG protein that binds DNA, Pleiohomeotic (Pho)^13,14. These two proteins cooperate in the recruitment of other PcG factors^15–19, which then mark the surrounding nucleosomes with the H3K27me3. In BX-C this histone mark helps establish and maintain the cisregulatory domains in the off state^{20, 21}. When the cis-regulatory domains are in the on state, PcG proteins and the H3K27me3 mark are replaced by Trx proteins and marks of active chromatin²².

Critical to the autonomous activity of the BX-C regulatory domains are another class of elements, called boundaries or insulators^23,24. Each of the BX-C regulatory domains is separated from the adjacent domains by boundaries. For example, iab-5 and iab-6 are separated from each other by Fab-6, while iab-6 is separated from iab-7 by the Fab-7 (Fig. 1). With the exception of Mcp, the boundaries in the Abd-B region (Fab-6, Fab-7 and Fab-8) have two critical activities^25–32. The first is blocking cross talk between adjacent domains. Boundary deletions fuse flanking regulatory domains, allowing adventitious interactions between initiators (and PREs) in each domain. Typically, the initiator in the more proximal domain activates the fused domain leading to a gain-of-function (GOF) transformation. When Fab-7 is deleted, for example, the iab-6 initiator activates iab-7 in PS11 where it would normally be off. This results in a transformation of PS11(A6) into PS12 (A7)²⁸. Smaller Fab-7 deletions that remove most of the boundary but retain iab-7 PRE (HS3) give a mixed GOF and LOF (Loss-of-function) transformations³³. In this case, the PRE is thought to silence some of the iab-6, iab-7 enhancers. The second function is boundary bypass. This activity is required when there are boundaries between the regulatory domain and its target promoter. As illustrated in Fig. 1A, there are two boundaries, Fab-7 and Fab-8, between iab-6 and Abd-B. In order to drive Abd-B expression in PS11, the tissue specific enhancers in iab-6 must bypass these two boundaries. Studies on Fab-7 and Fab-8 indicate that bypass activity, like insulation, is an intrinsic property^25,26,34. However, not all BX-C boundaries have bypass activity, nor do they need this activity. For example, Mcp marks the border between the abd-A and Abd-B regulatory domains. In this location, bypass activity is not needed, and Mcp lacks this function²⁶.

The most thoroughly studied BX-C boundary, Fab-7, consists of four hypersensitive regions, HS*, HS1, HS2 and HS3 ³⁵. Transgene and endogenous replacement experiments indicate that it is composed of multiple, partially redundant elements. For example, in transgene assays, fragments spanning HS*+HS1 + HS2, have enhancer blocking activity^36,37. These same sequences are sufficient to confer nearly full boundary function in the context of BX-C: they block iab-6:iab-7 cross talk and support bypass^27,38,39. In transgene assays^14,16 and also in genetic experiments³³, Fab-7 HS3 functions as a PRE. However, recent experiments showed that in addition to PRE activity, HS3 also has boundary function^27,39. In fact, a combination of the distal half of HS1, dHS1, plus HS3, has full function in Fab-7 boundary replacement experiments. Interestingly, a similar configuration of a boundary element and adjacent centromere distal PRE is observed for Mcp, Fab-6 and Fab-8, suggesting that this organization may have some functional significance. On the other hand, for Fab-8, the available evidence indicates that the nearby PREs is not important for full boundary function⁴⁰.

Here we have used boundary replacement experiments to analyze the functional properties of the Fab-6 boundary. The chromosomal segment that is thought to contain Fab-6 has two DNase I hypersensitive regions, HS1 and HS2 (Fig. 1B). Unlike other boundaries, both hypersensitive regions can function as PREs and silence mini-white reporters in transgene assays ^41,42. In addition, sequences spanning HS1 region also function as a boundary, blocking the white enhancer from activating white⁴¹. Consistent with this observation, there are two binding sites for the chromosome architectural protein dCTCF in HS1 and dCTCF together with CP190 are associated with HS1 in vivo^43,44. Moreover, as might be expected, blocking activity of HS1 is partially compromised in dCTCF mutants⁴¹. Several other lines of evidence argue that HS1 likely corresponds to Fab-6. First, Iampietro et al⁸ found that like other BX-C boundaries, deletion of HS1 results in a mixed GOF/LOF transformation of A5 towards A6 or A4 respectively. Second, Kyrchanova et al⁴⁵ showed that a 425 bp sequence spanning Fab-6 HS1 functionally interacts with Fab-7, Fab-8 and the promoter region of Abd-B in a transgene pairing assay. Here we report that the core of Fab-6 boundary maps to a 529 bp sequence spanning HS1. While this core sequence can rescue a deletion spanning HS1, it cannot by itself rescue an HS1 + HS2 deletion, nor can it substitute for Fab-7. Instead HS1 must be combined with an HS2 fragment or the Fab-7 HS3.

The role of the Fab-6 HS1 in the functioning of the iab-5 and iab-6 regulatory domains

Iampietro et al⁸ generated several deletions in the region between iab-5 and iab-6 that were expected to remove sequences critical for boundary function. One of these, Fab-6², removes ~ 8 kb including both HS1 and HS2. A second ~ 2 kb deletion, Fab-6³, extends from a site in iab-5 ~ 1.1 kb from HS1 to a site within HS1 located just beyond the CTCF sites (Fig. 1B). Both deletions give a mixture of GOF/LOF phenotypes in A5 (PS10) and A6 (PS11). A third ~ 4,7 kb iab-6^Δ7 deletion, that removes HS2, had no apparent phenotypic effects⁸. Based on these findings and those of Perez-Lluch et al⁴¹, it was proposed that HS1 is the core Fab-6 boundary while HS2 corresponds to the iab-6 PRE.

To more precisely map the sequences required for boundary function, we used CRISPR/Cas9 to generate a 1389 bp deletion, F6^1attP, that excises all of HS1 plus several hundred bp of surrounding DNA (Fig. 1 and S1). The CRISPR/Cas9 construct carries a dsRed reporter (3 × P3-DsRed) to select for deletion events. Also included is an attP site that can be used for boundary replacement experiments⁴⁶. In the adult cuticle the HS1 deletion, F6^1attP, displays a strong GOF transformation of segment A5 towards A6. This transformation is most clearly evident in the ventral sternite. Instead of the characteristic quadrilateral shape (wt: Fig. 1), the A5 sternite has a banana shape like that normally observed in A6. It also differs from wt in that it lacks bristles. On the other hand, there are patches of depigmented tissue in the A5 tergite, which is indicative of a LOF transformation towards A4. Interestingly, we also observe weak LOF transformations in A6. These include small depigmented patches in the A6 tergite, and an occasional bristle in the A6 sternite (F6^1attP, Fig. 2). The depigmentation seen in the tergite would be consistent with an A6◊A4 LOF transformation.

A similar, though not identical mixture of GOF/LOF cuticle phenotypes in A5 and a weak LOF phenotype in A6 were observed by Iampietro et al⁸ in their Fab-6³ deletion that removes part of iab-5 and most but not all of HS1 (Fig. 1A). One notable difference is that the GOF transformations of the sternite were much more modest in Fab-6³ than in F6^1attP. Presumably these differences reflect the locations of the deletion breakpoints.

The Fab-6 HS1 cooperates with HS2 in blocking crosstalk between the iab-5 and iab-6 in vivo

To further define sequences important for Fab-6 function we generated three replacements. The largest was 1330 bp and contained nearly the entire sequence deleted in F6^1attP. The two other replacements were 873 bp and 529 bp (Fig. 2A). All three included the two CTCF sites. We introduced these replacements into F6^1attP using the φC31 attP/attB integration system⁴⁶. To monitor blocking activity in the context of BX-C, the replacement included a minimal yellow reporter, mini-y (Fig. 2A). The reporter has a 340 bp yellow promoter linked to a yellow cDNA but lacks the wing, body and bristle enhancers of the endogenous yellow gene. As a result, mini-y expression depends upon enhancers in the neighborhood. The mini-y was placed relative to the test boundary sequences so that it is located in the iab-6 regulatory domain. To minimize any possible repressive effects of the iab-6 PRE a mCherry gene was placed in front of the reporter.

In order to recover insertion events and also to monitor blocking activity, we used a y¹ genetic background. In flies carrying the null y¹ allele, the tan gene is still expressed under the control of Abd-B and A5 and A6 have a light brown-yellow instead of black pigmentation⁴⁷ (Fig. 2B, wt y¹). When mini-y is introduced into the Fab^1attP deletion without a boundary, reporter expression is driven by enhancers in the fused iab-5:iab-6 domain. As can be seen by the dark pigmentation in the A5 and A6 tergites, the enhancers drive mini-y expression in both segments. However, as is observed when expression of the endogenous y gene is driven by Abd-B in the starting F6^1attP platform, there is “tan” pigmentation along the posterior margin of A5 as well as patches elsewhere in the tergite without pigmentation indicative of a LOF transformation of A5 into A4 (Fig. 2B). In these cells, the fused domain is shut down and mini-y (like Abd-B) is not expressed. A different pattern of mini-y expression is evident when the 1330 bp HS1 sequence is included in the replacement. In this case, mini-y is expressed at high levels throughout the A6 tergite, while expression is (with the exception of variable number of small darkly pigmented dots) absent in A5. Thus, the 1330 bp fragment effectively blocks crosstalk between iab-5 and iab-6. This is also true for the two smaller replacements, 873 bp and 529 bp. Both eliminate mini-y expression in A5 as effectively as the larger fragment. The blocking activity of these replacements is also evident in the morphological phenotypes of A5 in both y¹ and y⁺ flies. Like wt the A5 tergite is covered in trichome hairs, while the sternite has a quadrilateral shape with many bristles. These features indicate that even the smallest DNA sequence effectively blocks cross talk between iab-5 and iab-6. There was, however, one anomaly. In replacements carrying mini-y the A6 sternite has several bristles that are not seen in wt. However, this is likely due to promoter competition between mini-y and Abd-B for the iab-6 enhancers as it is not observed in the replacements after the mini-y is excised (Fig. 2B).

Fab-6 HS1 cannot substitute for Fab-7

In previous studies a deletion F7^attP50 (Fig. 3A) that replaces the four Fab-7 nuclease hypersensitive regions with an attP site was generated ²⁷. We used this platform to further assess the functional properties of Fab-6 HS1 (Fig. 3A). For this purpose, we introduced the 1330 bp and 873 bp Fab-6 fragments described above, and a 685 bp fragment that has the same proximal end as the 529 bp fragment.

The F7^attP50 deletions results is a complete GOF transformation, and in males both A6 and A7 are absent. Surprisingly, all three Fab-6 HS1 fragments failed to rescue F7^attP50 (Fig. 3B). In all three replacements, only a rudimentary A6th tergite is present, while there is no sternite. These findings indicate that Fab-6 HS1 is not sufficient to reconstitute a functional boundary in a different BX-C chromosomal context.

One plausible explanation is that the two deletions we have used to test Fab-6 HS1 boundary function are not equivalent. The Fab-7 deletion removes all of the nuclease hypersensitive regions including the HS3, which has both boundary and PRE activity. By contrast, the Fab-6 deletion only removes HS1 but not the HS2 PRE. If this explanation is correct, then it may be possible to reconstitute Fab-7 by combining DNA fragments that encompass Fab-6 HS1 and HS2.

To test this possibility, we generated a Fab-7 replacement F6^{1330 + 3212} that includes both HS1 and HS2. Figure 3 shows that the A6 segment is almost fully wild type, indicating that F6^{1330 + 3212} is an effective substitute for Fab-7. The tergite is fully formed and the trichome hairs are largely restricted to the anterior and lateral edges as in wt, while the sternite has the appropriate banana shape. However, there are two anomalies: there are patches of ectopic trichomes on the A6 tergite, while the sternite has several bristles. These weak LOF defects would suggest that the boundary bypass activity of F6^{1330 + 3212} is not fully effective. Alternatively, since both HS1 and HS2 have PRE activity, the two together could sometimes silence iab-6.

We also tested a 2264 bp fragment that includes the 1339 bp HS1, but extends in the opposite direction towards iab-5. Unlike the F6^{1330 + 3212}, F6²²⁶⁴ failed to substitute for Fab-7, suggesting that there are no additional sequences conferring insulator function on the centromere proximal side of Fab-6 HS1.

Combination of Fab-6 HS1 and Fab-7 HS3 substitutes for Fab-7

The finding that Fab-6 HS1 substitutes for Fab-7 when combined with HS2 suggests that that HS2 has both PRE and boundary activity like Fab-7 HS3.³⁹ If this idea is correct, then Fab-6 HS1 might be able to substitute for Fab-7 when linked to Fab-7 HS3. To explore this idea, we combined four different Fab-6 HS1 fragments (Fig. 3C and Fig. 2S) with Fab-7 HS3. The largest was F6¹³³⁰, while the smallest was F6^{425 45}. We also tested two intermediate Fab-6 fragments, F6⁷⁴⁴ and F6¹¹¹⁹ (Fig. 3).

The two larger combinations, F6¹³³⁰ + F7^HS3 and F6¹¹¹⁹ + F7^HS3, have similar activities. In both cases they rescue the GOF transformations of the F7^attP50 deletion. The sternite has the appropriate banana shape, while the tergite is wt in size (Fig. 3C). However, as observed for F6^{1330 + 3212}, the sternite usually has a few bristles, while there are ectopic trichome patches on the tergite. Surprisingly, the two smaller combinations, F6⁷⁴⁴ + F7^HS3 and F6⁴²⁵ + F7^HS3, fail to fully rescue F7^attP50. The GOF phenotypes are most pronounced in the F6⁴²⁵ + F7^HS3 combination where both the sternites and tergites are significantly reduced in size. In the case of F6⁷⁴⁴ + F7^HS3 the sternites are typically misshapen while the tegrites have nicks or are smaller than normal. As was the case for the larger F6 fragments, weak LOF phenotypes are also observed, likely due to minor defects in bypass activity.

Fab-6 HS1 + HS2 deletions have a more complete GOF phenotype

Our Fab-7 replacement experiments indicate that F6¹³³⁰ (HS1) must be combined either with the Fab-6 HS2 or Fab-7 HS3 to rescue the F7^attP50 deletion. To further pursue the role of the Fab-6 HS2, we designed a CRISPR/Cas9 deletion, F6^{1 + 2attP}, which is 5995 bp and removes both HS1 and HS2.

As anticipated from studies on Fab-7, the phenotype of F6^{1 + 2attP} differs from F6^1attP. As shown in Fig. 1A, there is a nearly complete GOF transformation of A5 towards A6. The difference in the phenotypic effects of F6^{1 + 2attP} and F6^1attP are most clearly evident in the A5 tergite. While the A5 tergite in F6^1attP has patches of unpigmented cuticle indicative of an LOF transformation, the A5 tergite in F6^{1 + 2attP} is fully pigmented in > 90% of the males. Similarly, though the A5 sternite in F6^1attP has an A6-like banana shape, it also has several bristles, which are not present in the A6 sternite. In F6^{1 + 2attP} the GOF transformation is more complete as the sternite lacks bristles in 70–80% of the males.

Thus, as was observed for Fab-7 deletions which retain or remove HS3³³, removing both Fab-6 HS1 and HS2 results in much more complete GOF transformation than HS1 only. In this context, we would note that a strong GOF transformation of A5 was not observed by Iampietro al⁸ in the Fab-6² deletion (Fig. 1B) which removes both Fab-6 HS1 and HS2. Instead they observed a mixed GOF/LOF phenotype not altogether different from their smaller deletion, Fab-6³. We suspect that the difference in phenotypes is that their deletion removes a larger segment from iab-5. At this point, it is not clear why the loss of iab-5 sequences enhances the LOF transformation of A5.

HS2 contributes to Fab-6 boundary activity

Next, we generated four F6^{1 + 2attP} replacements. The first replacement, F6¹³³⁰, has only HS1. The second, F6^{1330 + 3212}, has both HS1 and HS2, but lacks 730 bp between the HS1 and HS2. The third, F6^{1330 + 930}, has only HS1 and HS2. The fourth replacement was F6²²⁶⁴ which contains the 1330 bp HS1 sequence, but extends into iab-5 (see above). These fragments were introduced into the mini-y replacement vector (Fig. 4).

Figure 4 shows that the two replacements that contain only HS1, F6¹³³⁰ and F6²²⁶⁴ are unable to insulate mini-y and it is expressed in A5 and A6. Consistent with ineffective insulation, the sternite in A5 has a banana shape while the arrangement of the trichomes in the A5 tergite resembles that normally observed in A6 (they are restricted to the anterior and dorsal lateral margins). Both of these morphological features are indicative of a GOF transformation of A5 towards A6 and are observed with and without the mini-y reporter. It is worth noting that the GOF transformations are less complete when the mini-y reporter is present. Though the A5 sternite has a banana shape, it has some bristles while there are small patches of trichomes on the tergite. However, the ectopic bristles and trichomes disappear and the flies resemble the starting deletion, F6^{1 + 2attP} after excision of mini-y.

A different result is obtained when the replacement combined Fab-6 HS1 plus HS2. The pigmentation pattern in the A5 and A6 tergites of y¹; F6^{1330 + 3212} mini-y and y¹; F6^{1330 + 930} mini-y indicates the mini-y is (with the exception of a few small dots of pigmented cuticle in A5: see arrowhead) insulated from enhancers in iab-5. The morphology of the dorsal and ventral cuticle in A5 is also normal. The one possible exception is some gaps in the trichome field in the smaller F6^{1330 + 930} replacement.

These findings suggest that iab-6 PRE, HS2, contributes to boundary function much like is observed for Fab-7 where HS3 functions both as the iab-7 PRE and as part of the Fab-7 boundary. If this suggestion is correct, then one would predict that Fab-7 HS3 would be able to substitute for Fab-6 HS2. To test this prediction, we combined Fab-6 HS1 with Fab-7 HS3 (F6¹³³⁰ + F7^HS3). As shown in Fig. 4, the F6¹³³⁰ + F7^HS3 combination also restores boundary function.

Parasegment/segment identity depends upon the proper functioning of the different elements in each BX-C regulatory domains³. These elements include parasegment specific initiators that are determine the on/off state of domains early in development, elements that function to maintain the on/off state (PREs/TREs), and enhancers that drive expression of the homeotic genes in patterns appropriate for each parasegment. The regulatory domains are bracketed by chromatin boundaries, which are responsible for insulating regulatory elements within one domain from interactions with regulatory elements in neighboring domains. In addition to insulating activity, some of the BX-C boundaries can mediate interactions between enhancers in the regulatory domains and the relevant target promoter^25,26,34. This boundary bypass function requires long distance physical interactions between boundaries and compatible architectural elements associated with the promoters of the three homeotic genes.

Here we have investigated the insulating and bypass activities of the Fab-6 boundary, which is located between iab-5 and iab-6. Though the sequence organization of Fab-6 is very different from that of the Fab-7, there are some parallels in their properties. Deletions that remove Fab-7 HS*+HS1 + HS2 but retain the HS3 iab-7 PRE result in a mixed GOF/LOF transformation of A6³³. A similar mixed GOF/LOF phenotype, in this case in A5 is observed in deletions that remove only Fab-6 HS1. For the Fab-6 HS1 deletion, the GOF phenotype results from activation of iab-6 in PS10 by the iab-5 initiator, while the LOF phenotype is due to the silencing of iab-5 and iab-6 in PS10 by a mechanism dependent on the iab-6 PRE. Fab-7 deletions that remove all HS sites result in a complete GOF transformation of A6 (PS11) into A7 (PS12) ³³. A similar strong GOF transformation is observed when both Fab-6 HS1 and HS2 are deleted.

Also, in both cases boundary function is supplemented by elements that have PRE activity. For Fab-7, the iab-7 PRE (HS3) contributes to its boundary function. Fab-6 also depends on elements that have boundary and PRE activity. In transgene studies Perez-Lluch et al⁴¹ found that Fab-6 HS1 and HS2 silenced a white reporter by PcG dependent mechanism. In addition, HS1 also functions as a boundary in an enhancer blocking assays, and this activity depends upon the chromosomal architectural protein dCTCF. The conclusion that HS1 has boundary activity is supported by the studies of Iampietro et al⁸ as well as our experiments showing that a F6⁵²⁹ containing CTCF sites can rescue the GOF/LOF transformations of a F6^1attP deletion. On the other hand, even larger fragments extending to either side of the Fab-6 HS1 region are unable to rescue Fab-7^attP50 and F6^2attP deletions. However, Fab-6 HS1 can substitute for Fab-7 when it is combined with HS2. This observation suggests that HS2 functions not only as a PRE silencer, but also as a boundary. Consistent with this idea, we found that the Fab-7 deletion, F7^attP50, can also be almost fully rescued by combining Fab-6 HS1 and Fab-7 HS3. Rescuing of the large Fab-6 HS1 + HS2 deletion also requires a combination of Fab-6 HS1 with either HS2 or Fab-7 HS3.

It is interesting to compare Fab-6 with the two other Abd-B boundaries, Fab-7 and Fab-8. Like Fab-8, there are two CTCF motifs in Fab-6 HS1 that bind dCTCF in ChIP experiments^43,44,48. In spite of this similarity, Fab-6 HS1 is clearly not equivalent to Fab-8. Unlike Fab-6 HS1, a 337 bp Fab-8 fragment that includes the two CTCF sites can fully substitute for Fab-7^34,40. While Fab-7 does not interact with dCTCF, ChIP-seq analysis^49–52 indicate that several chromosomal architectural factors known to be important for Fab-7 boundary functions also appear to be associated with Fab-6 HS1. These common factors include the BEN DNA binding domain factors, Insensitive and Elba, Pita, and several proteins (GAF, Mod(mdg4) and CLAMP) that are thought to be components of the LBC (Late Boundary Complex) (Fig. 5). All of these factors also have recognition sequences in Fab-7 HS*, HS1 or HS2^{25,27,53−55} and are known to play a role in their boundary functions. As for Fab-6 HS2, ChIP experiments indicate that the Polycomb DNA binding protein Pleiohomeotic (Pho), and the three LBC proteins GAF, Mod(mdg4) and CLAMP localize to this hypersensitive region. The same proteins are found associated with Fab-7 HS3. These similarities in protein composition would potentially explain why Fab-7 HS3 can substitute for Fab-6 HS2. Clearly further analysis of the proteins associated with Fab-6 HS1 and HS2, and mutational studies will be required to confirm and extend these suggestions.

Generation of F6^1attP and F6^{1 + 2attP} deletions

The deletions were obtained by CRISPR/Cas9-induced homologous recombination. As a reporter, we used pHD-DsRed vector that was a gift from Kate O’Connor-Giles (Addgene plasmid # 51434). The plasmid was constructed in the following order: proximal arm-3×Р3:DsRed-distal arm. Arms for homology recombination were amplified by PCR from DNA isolated from Oregon line. For generation of the F6^1attP deletion, homology arms were obtained by DNA amplification between primers: F6ProxDRI: TATGAATTCCCCGAGACTAAACATAATTCGC; F6ProxRNde: TATCATATGACTGGCACCAGCTAATTGACAA; F6DistDSpe: TTACTAGTCATATTTGGGGATTTCTCTAAGTTTG; F6DistRPsc

TTTACATGTCCGTGGTCGTTTTTTGTGGTT. For generation of the F6^{1 + 2attP} deletion only distal arm was changed: i6SGII: ATTAGATCTGCAAACTCAGTGGGCTTTTC; i6SXho: ATTCTCGAGCTGGTTGTTGGGATCGGG. The guide RNAs were selected using the program “CRISPR optimal target finder” (O’Connor-Giles Lab): for F6^1attP GTGCGCTAAGCACGCATATT and GTGTGTGGTCCGCAATACAG deletion, for F6^{1 + 2attP} - AGTTTGCAAAGACAGTCCGT and GTGTGTGGTCCGCAATACAG. The breakpoints of the designed deletion: F6^1attP − 3R:16883201..16881813 and F6^{1 + 2attP} − 3R:16887807..16881813 16,869,768 according Genome Release r6.36.

To generate the desired deletions, the plasmid construct was injected into 58492 (Bloomington Drosophila Stock Center) embryos together with two gRNAs. Concentrations were as described in Gratz et al. (2014). The F0 progeny was crossed with y w; TM6/MKRS flies. Flies with potential deletions were selected on the basis of dsRed-signal in eyes and the posterior part of their abdomens and these flies were crossed with y w; TM6/MKRS flies. All independently obtained flies with dsRed reporter were tested by PCR. The successful deletions events were confirmed by sequencing of PCR products.

Generation of transgenic lines carrying different insertions in the Fab-7^attP50, F6^1attP and F6^{1 + 2attP} landing platforms.

The Fab-7^attP50 landing platform was described previously²⁷. The test replacement fragments were inserted in a plasmid carrying the rosy reporter and an attP site described in²⁷.

For the F6^1attP and F6^{1 + 2attP} landing platforms the replacement vector was a plasmid with the mini-yellow and mCherry reporter as shown in Fig. 1S. The Fab-6 fragments were obtained by PCR amplification. Their coordinates are shown in Figures according to the published sequences of the Bithorax complex⁵⁶.

Integration of the plasmids in the landing platforms was achieved by injecting the plasmid and a vector expressing the фC31 recombinase into embryos of yw; F6^1attP/ F6^1attP or yw; F6^{1 + 2attP}/F6^{1 + 2attP} line. The successful integrations were selected on the basis of expression of yellow reporter in abdominal segments. The integration of the replacement DNA fragments was confirmed by sequencing of PCR fragments.

The yellow and mCherry reporters were excised by Cre-mediated recombination between the lox sites.

All stocks are available upon request.

Cuticle Preparations

Cuticle preparations were carried out as described by²⁶.

Acknowledgements

We thank Farhod Hasanov for fly injections. We thank Natalya Klimenko (the Center for Precision Genome Editing and Genetic Technologies for Biomedicine, IGB RAS) for help with bioinformatica.

Author contributions

P.G., O.K. designed experiments. O.K., N.P. performed experiments. P.S., P.G., O.K. wrote the main manuscript text. O.K. prepared figures. All authors reviewed the manuscript.

Competing interests

The authors declare no competing interests.

Funding

This work was supported by the Russian Science Foundation, project no. 19-14-00103 (to O.K.). PS would like to acknowledge support from NIH R35 GM126975. Funding for open access charge: Russian Science Foundation.

Lewis, E. B. A gene complex controlling segmentation in Drosophila. Nature 276, 565–570 (1978).
Celniker, S. E., Keelan, D. J. & Lewis, E. B. The molecular genetics of the bithorax complex of Drosophila: characterization of the products of the Abdominal-B domain. Genes Dev. 3, 1424–36 (1989).
Maeda, R. K. & Karch, F. The open for business model of the bithorax complex in Drosophila. Chromosoma 124, 293–307 (2015).
Kyrchanova, O. et al. The boundary paradox in the Bithorax complex. Mech Dev 138, 122–132 (2015).
Starr, M. O. et al. Molecular dissection of cis-regulatory modules at the Drosophila bithorax complex reveals critical transcription factor signature motifs. Dev. Biol. 359, 290–302 (2011).
Drewell, R. A. et al. Deciphering the combinatorial architecture of a Drosophila homeotic gene enhancer. Mech. Dev. 131, 68–77 (2014).
Casares, F. & Sánchez-Herrero, E. Regulation of the infraabdominal regions of the bithorax complex of Drosophila by gap genes. Development 121, 1855–1866 (1995).
Iampietro, C., Gummalla, M., Mutero, A., Karch, F. & Maeda, R. K. Initiator elements function to determine the activity state of BX-C enhancers. PLoS Genet 6, e1001260 (2010).
Simon, J., Chiang, A. & Bender, W. Ten different Polycomb group genes are required for spatial control of the abdA and AbdB homeotic products. Development 114, 493–505 (1992).
Schwartz, Y. B. & Pirrotta, V. A new world of Polycombs: unexpected partnerships and emerging functions. Nat Rev Genet 14, 853–864 (2013).
Kassis, J. A., Kennison, J. A. & Tamkun, J. W. Polycomb and trithorax group genes in drosophila. Genetics 206, 1699–1725 (2017).
Kuroda, M. I., Kang, H., De, S. & Kassis, J. A. Dynamic Competition of Polycomb and Trithorax in Transcriptional Programming. Annu. Rev. Biochem. 89, 235–253 (2020).
Brown, J. L., Mucci, D., Whiteley, M., Dirksen, M.-L. & Kassis, J. A. The Drosophila Polycomb Group Gene pleiohomeotic Encodes a DNA Binding Protein with Homology to the Transcription Factor YY1. Mol. Cell 1, 1057–1064 (1998).
Mishra, R. K. et al. The iab-7 polycomb response element maps to a nucleosome-free region of chromatin and requires both GAGA and pleiohomeotic for silencing activity. Mol Cell Biol 21, 1311–1318 (2001).
Americo, J. et al. A complex array of DNA-binding proteins required for pairing-sensitive silencing by a polycomb group response element from the Drosophila engrailed gene. Genetics 160, 1561–71 (2002).
Hagstrom, K., Muller, M. & Schedl, P. A Polycomb and GAGA dependent silencer adjoins the Fab-7 boundary in the Drosophila bithorax complex. Genetics 146, 1365–1380 (1997).
Kahn, T. G. et al. Interdependence of PRC1 and PRC2 for recruitment to Polycomb Response Elements. Nucleic Acids Res. 44, 10132–10149 (2016).
Brown, J. L. & Kassis, J. A. Architectural and Functional Diversity of Polycomb Group Response Elements in Drosophila. Genetics 195, 407–419 (2013).
Ray, P. et al. Combgap contributes to recruitment of Polycomb group proteins in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 113, 3826–3831 (2016).
Cheutin, T. & Cavalli, G. The multiscale effects of polycomb mechanisms on 3D chromatin folding. Critical Reviews in Biochemistry and Molecular Biology vol. 54 399–417 (2019).
Bowman, S. K. et al. H3K27 modifications define segmental regulatory domains in the Drosophila bithorax complex. Elife 3, e02833 (2014).
Ciabrelli, F. et al. Stable Polycomb-dependent transgenerational inheritance of chromatin states in Drosophila. Nat. Genet. 49, 876–886 (2017).
Gyurkovics, H., Gausz, J., Kummer, J. & Karch, F. A new homeotic mutation in the Drosophila bithorax complex removes a boundary separating two domains of regulation. EMBO J 9, 2579–2585 (1990).
Chetverina, D. et al. Boundaries of loop domains (insulators): Determinants of chromosome form and function in multicellular eukaryotes. BioEssays 39, (2017).
Kyrchanova, O. et al. Complete reconstitution of bypass and blocking functions in a minimal artificial Fab-7 insulator from Drosophila bithorax complex. Proc. Natl. Acad. Sci. 116, 13462–13467 (2019).
Postika, N. et al. Boundaries mediate long-distance interactions between enhancers and promoters in the Drosophila Bithorax complex. PLOS Genet. 14, e1007702 (2018).
Wolle, D. et al. Functional Requirements for Fab-7 Boundary Activity in the Bithorax. Mol. Cell. Biol. (2015) doi:10.1128/MCB.00456-15.Address.
Karch, F. et al. Mcp and Fab-7: molecular analysis of putative boundaries of cis-regulatory domains in the bithorax complex of Drosophila melanogaster. Nucleic Acids Res 22, 3138–3146 (1994).
Iampietro, C., Cleard, F., Gyurkovics, H., Maeda, R. K. & Karch, F. Boundary swapping in the Drosophila Bithorax complex. Development 135, 3983–3987 (2008).
Iampietro, C., Gummalla, M., Mutero, A., Karch, F. & Maeda, R. K. Initiator elements function to determine the activity state of BX-C enhancers. PLoS Genet. (2010) doi:10.1371/journal.pgen.1001260.
Barges, S. et al. The Fab-8 boundary defines the distal limit of the bithorax complex iab-7 domain and insulates iab-7 from initiation elements and a PRE in the adjacent iab-8 domain. Development 127, 779–790 (2000).
Bender, W. & Lucas, M. The border between the Ultrabithorax and abdominal-A regulatory domains in the Drosophila bithorax complex. Genetics (2013) doi:10.1534/genetics.112.146340.
Mihaly, J., Hogga, I., Gausz, J., Gyurkovics, H. & Karch, F. In situ dissection of the Fab-7 region of the bithorax complex into a chromatin domain boundary and a Polycomb-response element. Development 124, 1809–1820 (1997).
Kyrchanova, O. et al. Distinct Elements Confer the Blocking and Bypass Functions of the Bithorax Fab-8 Boundary. Genetics 213, 865–876 (2019).
Galloni, M., Gyurkovics, H., Schedl, P. & Karch, F. The bluetail transposon: evidence for independent cis-regulatory domains and domain boundaries in the bithorax complex. EMBO J 12, 1087–1097 (1993).
Hagstrom, K., Muller, M. & Schedl, P. Fab-7 functions as a chromatin domain boundary to ensure proper segment specification by the Drosophila bithorax complex. Genes Dev 10, 3202–3215 (1996).
Zhou, J., Barolo, S., Szymanski, P. & Levine, M. The Fab-7 element of the bithorax complex attenuates enhancer-promoter interactions in the Drosophila embryo. Genes Dev. 10, 3195–3201 (1996).
Mihaly, J. Dissecting the regulatory landscape of the Abd-B gene of the bithorax complex. Development 133, 2983–2993 (2006).
Kyrchanova, O. et al. The bithorax complex iab-7 Polycomb response element has a novel role in the functioning of the Fab-7 chromatin boundary. PLOS Genet. 14, e1007442 (2018).
Kyrchanova, O. et al. Functional Dissection of the Blocking and Bypass Activities of the Fab-8 Boundary in the Drosophila Bithorax Complex. PLoS Genet. 12, e1006188 (2016).
Perez-Lluch, S., Cuartero, S., Azorin, F. & Espinas, M. L. Characterization of new regulatory elements within the Drosophila bithorax complex. Nucleic Acids Res 36, 6926–6933 (2008).
Ivlieva, T. A., Georgiev, P. G. & Kyrchanova, O. V. Study of the enhancer-blocking activities of new boundaries in the bithorax complex of Drosophila melanogaster. Russ. J. Genet. 47, 1184–1189 (2011).
Smith, S. T. et al. Genome wide ChIP-chip analyses reveal important roles for CTCF in Drosophila genome organization. Dev. Biol. 328, 518–528 (2009).
Holohan, E. E. et al. CTCF genomic binding sites in Drosophila and the organisation of the bithorax complex. PLoS Genet. (2007) doi:10.1371/journal.pgen.0030112.
Kyrchanova, O. et al. Selective interactions of boundaries with upstream region of Abd-B promoter in Drosophila bithorax complex and role of dCTCF in this process. Nucleic Acids Res. 39, 3042–3052 (2011).
Bischof, J., Maeda, R. K., Hediger, M., Karch, F. & Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104, 3312–3317 (2007).
Camino, E. M. et al. The Evolutionary Origination and Diversification of a Dimorphic Gene Regulatory Network through Parallel Innovations in cis and trans. PLOS Genet. 11, e1005136 (2015).
Bonchuk, A. et al. Functional role of dimerization and CP190 interacting domains of CTCF protein in Drosophila melanogaster. BMC Biol. 13, 63 (2015).
Maksimenko, O. et al. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin. Genome Res 25, 89–99 (2015).
Ueberschär, M. et al. BEN-solo factors partition active chromatin to ensure proper gene activation in Drosophila. Nat. Commun. 10, 5700 (2019).
Rieder, L. E., Jordan, W. T. & Larschan, E. N. Targeting of the Dosage-Compensated Male X-Chromosome during Early Drosophila Development. Cell Rep. 29, 4268–4275.e2 (2019).
Negre, N. et al. A cis-regulatory map of the Drosophila genome. Nature 471, 527–531 (2011).
Kyrchanova, O. et al. Architectural protein Pita cooperates with dCTCF in organization of functional boundaries in Bithorax complex. Development 144, 2663–2672 (2017).
Kaye, E. G. et al. Drosophila dosage compensation loci associate with a boundary-forming insulator complex. Mol. Cell. Biol. 37, 1–18 (2017).
Fedotova, A. et al. Functional dissection of the developmentally restricted BEN domain chromatin boundary factor Insensitive. Epigenetics Chromatin 12, 2 (2019).
Martin, C. H. et al. Complete sequence of the bithorax complex of Drosophila. Proc Natl Acad Sci U S A 92, 8398–8402 (1995).

PDF

Journal Publication

published 18 Feb, 2021

Read the published version in Scientific Reports →

Editorial decision: Major revision
12 Jan, 2021
Reviews received at journal
31 Dec, 2020
Reviewers agreed at journal
18 Dec, 2020
Reviewers agreed at journal
16 Dec, 2020
Reviewers invited by journal
15 Dec, 2020
Editor assigned by journal
15 Dec, 2020
Editor invited by journal
15 Dec, 2020
Submission checks completed at journal
14 Dec, 2020
First submitted to journal
04 Dec, 2020

You are reading this latest preprint version

Mapping of functional elements of the Fab-6 boundary involved in the regulation of the Abd-B hox gene in Drosophila melanogaster

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Cuticle Preparations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1