Chondrocytes culture
ATDC5 cells (Fuheng Centre Cell Bank, China), a murine chondrogenic cell line, were cultured in Dulbecco’s Modified Eagle’s Medium/Ham’s F-12 Nutrient Mixture (DMEM/F-12; Gibco, USA) containing 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin (Gibco, USA). Cells were maintained in a humidified atmosphere containing 5% CO2 at 37 °C. After the cells had reached 80–90% confluence, they were collected for experimentation. The medium was changed every two days. Then ATDC5 were treated with recombinant mouse IL-1β (10 ng/mL) to simulate the inflammatory environment of OA.
Cell transfection
Chondrocytes were inoculated into 6-well plates (Corning, NY, USA) at a density of 5 × 105 cells/well (Corning, NY, USA). According to the manufacturer’s instructions, the Vangl2 small interfering RNA (siRNA; RiboBio; Guangzhou, China) and negative control (nc; RiboBio; Guangzhou, China) were transfected by using Lipofectamine RNAiMAX (Invitrogen, CA, USA) when the cell fusion rate reached 50%-70%. To establish Wnt5a overexpressing cells, we used Lipofectamine 2000 (Invitrogen, CA, USA) to transfect plasmids targeting Wnt5a and negative control (NC) after cells reached 70% confluence. The medium was replaced with DMEM/F12 supplemented with 10% FBS after 6 h.
RNA Quantification by Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Amplification
Total cell RNA was extracted by using TRIzol. The mRNA was mixed with the PrimeScript RT Master Mix (Perfect Real Time; Takara, Japan) and RNase-free water, then reverse-transcribed into cDNA according to the manufacturer's instructions. The primers used for RT-qPCR were listed in Table 1. qPCR was performed by the SYBR® Green RT-qPCR kit (Roche Diagnostics, Switzerland) and a Roche light cycle 96 (Roche, Switzerland). The GAPDH mRNA expression level is used for normalization, and the mRNA expression levels were calculated using the 2−ΔΔcq method. We assigned an arbitrary value of 1 for each control expression level. The treated samples were evaluated as fold change over control.
Table 1
Primer sequences for PCR.
Gene (mouse) | Primer sequence (3'→5') forward | Primer sequence (3'→5') reverse |
Wnt5a | ATGCAGTACATTGGAGAAGGTG | CGTCTCTCGGCTGCCTATTT |
Vangl2 | GGGATGGGAGTCGTGGAGATA | TCATGGGAGATACTGTGCTCAG |
MMP3 | ACATGGAGACTTTGTCCCTTTTG | TTGGCTGAGTGGTAGAGTCCC |
MMP9 | CTGGACAGCCAGACACTAAAG | CTCGCGGCAAGTCTTCAGAG |
MMP13 | CTATCCCTTGATGCCATTACCAG | ATCCACATGGTTGGGAAGTTC |
Col-2 | CAGGATGCCCGAAAATTAGGG | ACCACGATCACCTCTGGGT |
IL-6 | CCAAGAGGTGAGTGCTTCCC | CTGTTGTTCAGACTCTCTCCCT |
IL-8 | CAAGGCTGGTCCATGCTCC | TGCTATCACTTCCTTTCTGTTGC |
TNF-α | GACGTGGAACTGGCAGAAGAG | TTGGTGGTTTGTGAGTGTGAG |
Western blotting
Cells were treated by RIPA lysis buffer (Beyotime Institute of Biotechnology, China) supplemented with 1% protease and phosphatase inhibitors (Beyotime, China). Then a bicinchoninic assay (Beyotime, China) was used to measure protein concentration. Protein samples were added to the loading buffer (loading buffer to sample ratio, 1:4) and were heated to 99 ℃ for 10 minutes to denature the proteins. 8% or 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Beyotime, China) was used to separate proteins, followed by transferring to polyvinylidene fluoride membranes (Millipore, USA), and by blocking with 5% non-fat milk (BD Biosciences, USA) for 1 hour (h) at room temperature (RT). The blot was incubated with primary antibodies (1:1,000 dilutions) overnight at 4 ̊C. (rabbit antibodies against MMP3, MMP9, MMP13, IL‐6, aggrecan, p38, phosphorylated (p)-p38, and GAPDH (Affinity Biosciences, USA); rabbit antibodies against ERK, p-ERK, JNK, p-JNK, p65, p-p65 (Cell signaling Technology, USA) and Col-2 (1:1000; Bioss, China); mouse antibodies against Vangl2 (1:400; Santa Cruz, USA)). Then the blots were washed for 5 minutes (min) 5 times by phosphate-buffered saline supplemented with 0.05% Tween 20 (TBST) at RT. Then they were incubated with a horseradish peroxide-conjugated goat anti-rabbit or anti-mouse IgG (1:2000; Cell Signaling Technology, USA) for 1 h (RT). An ECL Kit (Millipore, USA) was used to visualize the protein blots and Image J (version: 1.52t; National Institutes of Health) was used for semi-quantitative analysis.
Cell Immunocytofluorescence (IF)
5000 ATDC5 were seeded in a 35-mm dish for confocal laser-scanning microscopy (MatTek Corporation, USA). Cells were treated after 24 h and then the culture medium was discarded. After being washed with PBS three times, the cells were fixed with 4% paraformaldehyde (Beyotime, China) for 15 min (RT). Subsequently, the cells were permeabilized with 0.1% Triton X-100 and blocked in 5% bovine serum albumin (BSA) for 1 h. Mouse anti-Vangl2 (1:400, Santa Cruz, USA) antibody was added to the dishes for incubation at 4 °C overnight. Cells were incubated in the dark for 1 h with secondary antibodies (488 DyLight goat anti-mouse IgG; 1:100; EarthOx, USA). The nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Beyotime, China) for 5 min after being washed with PBS. Then the cells were observed under a fluorescence microscope (Carl Zeiss, Germany).
Immunocytochemical (ICC) staining
The transfected ATDC5 were grown on glass coverslips that were previously coated with poly L-lysin. Then they were fixed in 4% paraformaldehyde (Beyotime, China) for 15 min (RT). Permealization was done by immersing slides in 0.3% Triton-X100 (MP Biomedicals, USA) for 15 min. Two drops of the rabbit primary antibody against Col-2 (1:400) were applied to each slide. Then the samples were incubated at 4 °C overnight. The next day, the Horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit) was applied to each slide for 1 h. Subsequently, DAB (Zhongshan Jinqiao Biotechnology, China) was prepared and was used for visualizing any antigen-antibody reaction in the cells. The stained sections were observed and recorded by a light microscope (Leica, German).
Statistical analysis
All statistical calculations were performed using SPSS 25.0 (IBM, USA) and each assay was performed with at least three technical and biological replicates. Normally distributed data were expressed as means ± standard deviations. Students t-test was used to analyze the differences between the two groups. Significant differences between more than two groups were determined by the analysis of variance (ANOVA). P < 0.05 was considered to indicate a statistically significant difference.