Fine-mapping the recently discovered QTL qMrdd2 that confers resistance to maize rough dwarf disease

doi:10.21203/rs.2.21742/v1

Download PDF

Research article

Fine-mapping the recently discovered QTL qMrdd2 that confers resistance to maize rough dwarf disease

https://doi.org/10.21203/rs.2.21742/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 23 Jan, 2020

You are reading this latest preprint version

Background: Maize rough dwarf disease (MRDD) is a disease caused by a virus that seriously affects maize yield and quality worldwide. Rice black streaked dwarf virus (RBSDV) in the Fijivirus genus in the Reoviridae family causes MRDD in maize. Typical MRDD symptoms of include severe dwarfing of plants, shortening of internodes. MRDD resistance is a complex trait that is quantitatively inherited and is controlled by several quantitative trait loci (QTL). MRDD is most efficiently controlled by the cultivation of disease-resistant corn hybrids. Results: Disease resistance in the MRDD-resistant Qi319 and -susceptible Ye478 parental inbred lines and the 314 recombinant inbred lines (RILs) that were derived from a cross between them was evaluated across three environments. A stable resistance QTL, qMrdd2 , which explained 8.64 to 11.02% of the total phenotypic variance in MRDD resistance, was identified repeatedly and was mapped using BLUP values to a 0.55-Mb region between the markers MK807 and MK811 on chromosome 2. We validated the effect of qMrdd2 using a chromosome segment substitution line population that were derived from a cross between maize inbred Qi319 as the resistance donor and Ye478 as the recipient. The disease-severity index (DSI) of CSSL haplotype II harboring qMrdd2 was significantly lower than the DSI of susceptible parent Ye478 ( P < 0.05). Mapping results using CSSLs were consistent with localization interval determined using RILs. The qMrdd2 locus acted with an additive effect but no significant dominant gene action in conferring MRDD resistance. We fine-mapped qMrdd2 locus into a 315-kb region flanked by the markers RD81 and RD87 by testing recombinant-derived progeny using selfed backcrossed families. Conclusions: qMrdd2 is a recently discovered QTL from Qi319 for resistance to MRDD with an additive effect but no significant dominant gene action for MRDD resistance. qMrdd2 was fine-mapped to a 315-kb interval on maize chromosome 2. Introgression of the MRDD resistance allele at the qMrdd2 locus of CSSL haplotype 2 using linked markers umc1824 and bnlg125 will be useful for maize breeding to reduce yield losses caused by MRDD. Keywords: Maize, Maize rough dwarf disease, QTL, Fine-mapping, RIL；CSSL.

Plant Physiology and Morphology

Plant Molecular Biology and Genetics

Maize

Maize rough dwarf disease

QTL

Fine-mapping

Recombinant inbred line

Chromosome segment substitution line.

Maize is an important food, feed, and energy crop with an essential role in agricultural production and economic development. Various diseases of maize have been discovered that seriously affect the yield and quality of maize. MRDD is a major viral disease that adversely affects maize production. In 1949, corn shrinkage disease due to MRDD was first reported in Italy, followed by Argentina, France, Spain, Iran, and Greece [1–4]. Since the 1990s, changes in climate and crop rotation patterns have resulted in widespread MRDD in the Huanghuaihai corn production area of China [5]. Rice black-streaked dwarf virus (RBSDV), the pathogen that causes MRDD, is a member of the Fijivirus genus in the Reoviridae, a family of viruses that also includes maize rough dwarf virus (MRDV), Mal de Río Cuarto virus (MRCV), and southern rice black-streaked dwarf virus (SRBSDV) [6–9]. In China, the small brown planthopper (SBPH) vector, Laodelphax striatellus transmits RBSDV, which causes MRDD by its. The typical symptoms of MRDD are severe dwarfing of plants; shortening of internodes; thickened, short, and stiff green leaves, slow development of roots, and malformed or underdeveloped male and female ears [10–12]. Plants with severe disease will die early, which results in decreased yield. In addition, the disease can also harm crops such as barley, wheat, oats, sorghum, and millet, with similar symptoms [13–14]. The occurrence of MRDD is affected by many factors, such as the number of vectors, the presence of host weeds, field layout, crop rotation, environmental conditions, and the disease resistance of plant varieties. At present, the adjustment of sowing dates and the use of chemical agents for preventing and controlling disease are common approaches for limiting MRDD. Appropriate adjustment of the sowing period to allow corn seedlings to avoid the peak period of inoculation with RBSDV by adult planthoppers can reduce the MRDD incidence rate [15]. However, with their disadvantages of high risk and low efficiency, the use of these methods can still result in significantly decreased maize yield. Chemical controls increase the costs of economic inputs and can cause environmental pollution. Therefore, MRDD is most efficiently controlled by cultivating excellent disease-resistant corn hybrids, which is also safer for the environment than the use of pesticides [16–18].

The identification of maize germplasm that is resistant to MRDD is the basis for the cloning MRDD resistance genes and the breeding of resistant maize varieties. Many studies conducted in China have screened for MRDD-resistant corn germplasm under conditions of natural MRDD infection. At present, many studies have effectively combined disease-resistant maize inbred lines with breeding results based on heterosis groupings (BSSS, PA, Lancaster, Lvda Red Cob, Sipingtou, and PB) to produce disease-resistant hybrid maize [19–22]. The most disease-resistant heterotic subgroup, PB, exhibits a disease incidence rate of 1.6% and some of the highest rates of disease resistance. Resistance to MRDD in China was inherited from US maize hybrid P78599 and the MRDD-resistant lines derived from it include Qi319, Shen137, SH15, 89 − 1, Golden 59, X178, and P138 [19–22].

MRDD resistance is a complex quantitative trait that is controlled by many genes with small effects [23–30]. F_2:3 QTL mapping has allowed detection of two QTL that together explained 36.2% of the phenotypic variance in resistance to MRDD in F_2:3 progeny of the MRDD-resistant inbred BLS14 and the susceptible inbred Mo17 [25]. In the F₂ population of a cross between resistant inbred 90110 and susceptible inbred Ye478, three QTL located in chromosome bins 6.02, 7.02, and 8.07 [26] together explained 20% of the phenotypic variance in MRDD resistance. A similar study using RILs derived from 90110 × Ye478 identified five QTLs, one of which was a major QTL in chromosome bin 8.07 that explained 28.9% of phenotypic variance in resistance to MRDD [27]. In 2011, a major QTL from the resistant inbred line X178 detected in chromosome bin 8.03 explained between 24.6% and 37.3% of the phenotypic variance in MRDD resistance [28]. The major recessive QTL that could explain 24.6 to 37.3% of the phenotypic variance in resistance to MRDD, qMrdd1, which originated from resistant inbred X178, was identified in a 1.2-Mb region of bin 8.03 [29]. Subsequently, qMrdd8 was fine-mapped into a 347-kb interval in which one SNP and two InDels were significantly associated with MRDD resistance [30].

In the present study, the genetic effects of qMrdd2, which confers MRDD resistance, were analyzed using the RIL and CSSL populations derived from a cross between Ye478 and Qi319 to identify and verify regions of the maize genome containing this QTL. qMrdd2 was then fine mapped by performing recombinant-derived progeny testing with self-pollinated families. The objectives of the present study were to identify, verify, and fine-map the qMrdd2, which confers resistance to MRDD in Qi319; to identify markers that are tightly linked to the qMrdd2 region, and to develop these markers for subsequent marker-assisted selection (MAS) of MRDD resistance.

Phenotypic evaluation of resistance to MRDD in parents and RILs

The MRDD resistance of parental inbred lines Qi319 (MRDD-resistant) and Ye478 (MRDD-susceptible) and 314 RILs derived from a cross between them was evaluated at Xuzhou in 2015 and 2016 and at Xinxiang in 2016. Descriptive statistics for MRDD resistance in the three environments are shown in Table 1, and in Figure 2A and 2B. ANOVA revealed highly significant differences (P < 0.01) between the resistant inbred line Qi319, with an average DSI of 13.75, and the susceptible inbred line Ye478, with an average DSI of 71.35 in the three environments. The parental lines Qi319 and Ye478 consistently exhibited either MRDD resistance or susceptibility in each year and location (Figure 2A and 2B). The average DSI of each RIL was used to represent the disease resistance of each line. The continuous, normal distributions of phenotypes in the field from highly MRDD resistant to completely susceptible reflected the quantitative control of MRDD resistance in maize (Figure 2C). The broad-sense heritability (H²) of resistance to MRDD ranged from 76.98 % to 81.67 % in the RILs (Table 1). Meanwhile, the parents Qi319, Ye478, and their F₁ were also mock-inoculated by virus-free SBPH as a control. The numbers of surviving virus-free SBPH did not differ significantly (P > 0.05) among Qi319, Ye478, and their F₁ from the first day to the seventh day (Figure 2D), which implied that the QTL controls resistance to MRDD, not to the SBPH pest.

Identification of QTL for MRDD resistance

In the present study, a stable QTL for resistance to MRDD that explained 8.17 to 11.02 % of the total phenotypic variation in MRDD resistance across three environments was identified on chromosome 2 using genotypes and phenotypic values in the 314 RILs (Table 2 and Figure 3A). Alleles for MRDD resistance came from the resistant parent Qi319 and increased phenotypic values for MRDD resistance in all three environments. In 2015, the significant QTL qMrdd2 was identified between MK806 and MK811 on chromosome 2 (LOD score = 5.83) and explained 8.17% of the phenotypic variation in MRDD resistance (Table 2). In 2016, another significant QTL for resistance to MRDD was detected in the same region and explained 8.64% and 11.02% of the total phenotypic variance at Xuzhou and Xinxiang, respectively. The CIs for these two QTL covered average physical distances of 0.15 Mb on the B73 RefGen_v3 reference genome (Table 2). The stable resistance QTL, designated qMrdd2, was identified repeatedly and was mapped using BLUP values into a 0.55-Mb region between the bin markers MK807 and MK811 on the B73 RefGen_v3 genome.

Validation the effect of qMrdd2 in CSSL populations

The effect of qMrdd2 was investigated in a CSSL population derived from a cross between Qi319 and Ye478 that carried different haplotypes for the segments covering chromosome 2. The average background recovery rates by molecular MAS (BC₅F₂) of these eight CSSLs ranged from 91.45% to 99.62% (Table 4). Combined with the DSI (%) field phenotypic values for plants in three different environments, we found that CSSL haplotype II, which carries the introgressed segment including qMrdd2 flanked by linked markers umc1824 and bnlg125, was associated with MRDD resistance, with DSIs of 20.01%, 56.73%, and 51.71%, respectively (Table 4, Figure 3B and 3C). The DSI of CSSL haplotype II harboring qMrdd2 was significantly lower than that of the MRDD-susceptible parent Ye478 (P < 0.05) in three different environments (Figure 3B and 3C). The length of the introgressed qMrdd2 fragment in CSSL haplotype II was about 7.0 Mb, according to B73 RefGen_v3 (Table 4). These mapping results were consistent with the mapping of this interval using RILs and indicate that qMrdd2 could be used to improve resistance to MRDD. Therefore, we knew that the introgression of CSSL haplotype II using the linked markers umc1824 and bnlg125 could be performed to construct secondary backcross populations or selfed segregating populations for fine-mapping of qMrdd2.

Fine-mapping of qMrdd2

To fine-map qMrdd2, we designed 150 InDel primer pairs within the qMrdd2 region based on 30× genome sequencing of the resistant parent Qi319 and the susceptible parent Ye478, and detected 13 polymorphic InDel markers between Qi319 and Ye478, as shown in Table 3. The flanking SSR markers umc1824a and bnlg125 were first used to identify recombinants from 6000 BC₁F₂ plants and 6000 F₃ plants in the winter nursery of Hainan in 2016. The recombinants were self-pollinated to generate BC₁F₃ and F₄families and their genotypes were resolved using the 13 polymorphic InDel markers distributed throughout the qMrdd2 region. Finally, a total of 16 recombinant haplotypes were detected (Figure 4).

In 2017, the recombinant-derived families represented 16 haplotypes, 10 of which were homozygous, were selected and planted for fine-mapping of qMrdd2 in three locations. The MRDD resistance of each of the 10 homozygous recombinant-derived families (Haplotypes VII–XVI) were evaluated for under conditions of natural infection and planted with Ye478 in a 1:1 ratio (Figure 4). Most of the haplotypes VII–XI were highly susceptible to MRDD and most of the haplotypes XII–XVI were highly resistant to MRDD regardless of genotype in three locations. The exceptions were haplotype X in Xuzhou, for which the DSI did not significantly differ from Ye478 (Student’s t-test, P > 0.05), and haplotypes XII–XVI, for which DSIs differed significantly from Ye478 (Student’s t-test, P < 0.05) (Fig. 4). These results indicated that qMrdd2 was located between RD56 and RD114. The DSIs of haplotype X in Xuzhou differed significantly from that of Ye478. At the same time, 1079 BC₁F₃ individuals derived from 28 recombinants including six haplotypes I–Ⅵ were selected and planted in Xinxiang, Xuzhou, and Jining. Within the heterozygous region of qMrdd2, the three genotypes of the BC₁F₃ individuals were Qi319/Qi319, Ye478/Ye478, or heterozygous Qi319/Ye478. The DSIs of these three genotypes were evaluated separately under conditions of natural infection and calculated for each BC₁F₃ family. Analyzing the combined genotypic and phenotypic data revealed significant differences in DSI among the three genotypes for haplotype I at any field location. This result implied that qMrdd2 could be located within the heterozygous region but not in the homozygous Qi319 region. The remaining haplotypes (II-VI) were resistant to MRDD as no significant differences were detected among the three genotypes according to one-way ANOVA (P > 0.05). This result implied that qMrdd2 could be located within the homozygous Qi319 region but not in the heterozygous region. Based the above results, the qMrdd2 was fine-mapped into a 315-kb interval between the markers RD81 and RD87.

Model of gene action for MRDD resistance controlled by qMrdd2

We examined the nature of the gene action controlling resistance to MRDD by qMrdd2 in F₂ families categorized according to their genotypes within qMrdd2 region between markers RD81 and RD87, Qi319/Qi319, Qi319/Ye478, and Ye478/Ye478. The DSI of plants that were homozygous (Qi319/Qi319) for the Qi319 allele in the qMrdd2 region was significantly lower than in the plants with homozygous Ye478 genotypes (Ye478/Ye478). The DSI for heterozygotes was intermediate between those of the homozygous Qi319 and Ye478 genotypes (Figure 5). In Jining, 750 F₂ plants were evaluated for resistance to MRDD. the plants with the homozygous genotype Ye478/Ye478 (DSI 88.65%) had a higher DSI (P < 0.05) than those with the homozygous genotype Qi319/Qi319 (DSI 50.02%). Furthermore, the DSI of plants carrying the heterozygous genotype Qi319/Ye478 (DSI 74.20%) was close to the mid-parent value of the homozygous genotypes Qi319/Qi319 and Ye478/Ye478. In Xinxiang, 500 F₂ plants were evaluated for resistance to MRDD and a similar model for the gene action of qMrdd2 was found. DSIs were 55.19%, 82.92%, and 61.04% for plants carrying homozygous Qi319/Qi319, Ye478/Ye478, and heterozygous Qi319/Ye478 alleles, respectively. These results indicate that qMrdd2 exerts an additive effect but no significant dominant gene action on MRDD resistance.

A recently discovered QTL conferring MRDD resistance in maize

The genetic basis for quantitative genetic traits often involves multiple QTL, including those with large and small effects [28-32]. Relative to traits controlled by one or a few genes, quantitative genetic traits controlled by QTL, especially major QTL, are vital genetic resources for improving crop traits. Because MRDD is a complex viral disease, it was important to choose a suitable resistant parent for identifying disease resistance in segregating progeny as the basis for QTL mapping. Several MRDD-resistance loci have so far been reported in the maize genome. Several of these candidate genes for disease resistance loci have been fine-mapped or cloned. For example, as mentioned above, a major recessive QTL, qMrdd1, explaining 24.6 to 37.3 % of the phenotypic variance in resistance to MRDD, originated from the MRDD-resistant inbred X178 and was identified in a 1.2-Mb region of bin 8.03 [29]. Later, qMrdd8 was fine-mapped into a 347-kb interval in which one SNP and two InDels were significantly associated with MRDD resistance [30]. Five other QTL located on chromosome 2 (bin 2.02), 6 (bin 6.02), 7 (bin 7.02), 8 (bin 8.07), and 10 (bin 10.05) that explained 11.9 to 34.8 % of the phenotypic variance in MRDD resistance, were identified using F₂ and BC₁ populations combined with bulked segregate analysis (BSA) [27]. Many screens for MRDD resistance in maize germplasm have been conducted in China under natural MRDD infection conditions. The major sources of MRDD resistance currently used in China have been derived from the US maize hybrid P78599 and include Shen137, SH15, 89-1, Golden 59, X178, and P138 [19-22]. In our study, we consistently detected a stable resistance QTL, derived from the inbred Qi319 in the PB heterotic group and mapped qMrdd2 using BLUP values (Table 2) to a 0.55-Mb region between the bin markers MK807 and MK811, according to the B73 RefGen_v3 genome. The PB group includes tropical maize germplasm from the Americas. However, the haplotypes carrying the resistance gene qMrdd8 derived from X178 are different from the haplotypes carrying the resistance gene qMrdd2 derived from Qi319, which suggests that these two MRDD-resistant materials (X178 and Qi319) might possess different mechanisms of resistance to MRDD [30]. These results further suggest that Qi319 could serve as a parent for breeding new disease-resistant hybrids. Future experiments using lines derived from X178 and Qi319 should also help clarify the genetic mechanisms of MRDD resistance and will have important theoretical and applied consequences for breeding maize varieties resistant to MRDD.

Validation of the genetic action of qMrdd2 in both RILs and CSSLs

Both genetic background and the environment can influence the resistance of plants to viruses [33, 34]. Choosing a suitable mapping population for phenotyping disease resistance is essential for QTL mapping. Compared with traditional mapping populations, the number of markers used to construct genetic linkage maps is relatively small, so their resolution is low and the confidence intervals for targeted QTL are typically between 10 and 20 cM. Such large intervals make molecular marker-assisted breeding difficult and imprecise and also limits the deep analysis of genes conferring disease resistance in maize. Genotyping-by-sequencing (GBS) has become a popular new method for acquiring dense genome-wide markers and has been successfully used for genetic studies in a variety of species [35, 36]. In two studies, an F₂ and the US-NAM population were subjected to GBS to increase marker densities to 6533 and 5296 markers, respectively [37, 38]. A high-density linkage map with 4183 bin markers and an average marker interval of 0.37 cM was constructed to map QTL for flowering and plant architecture-related traits in a maize RIL population [39]. In the present study, a stable QTL on chromosome 2 that explained 8.17 to 11.02% of the total phenotypic variation in MRDD resistance was identified in three environments using genotypes and phenotypic BLUP values in 314 RILs (Table 2 and Fig. 3A). The studies have fully demonstrated the feasibility, accuracy, and efficiency of GBS technology for the construction of genetic maps in maize.

The phenotypic differences between CSSLs and their recurrent parents can be considered to be due to the introduction of the fragment [40]. Therefore, a QTL located in the chromosome segment carried by the introduced fragment can be identified by analyzing the phenotypic differences between a CSSL and its recurrent parent, and provides material for the exploration of the QTL controlling a target trait [40]. Because CSSLs can eliminate most of the interference from the genetic background the gene/QTL introduced by the fragment can be regarded as a single Mendelian factor in a near-isogenic line, which lays the foundation for fine mapping of the gene responsible for the QTL [41-43]. CSSLs allow genetic effects to be more accurately estimated in particular backgrounds [40]. Stepwise regression in data from 130 CSSLs was used to detect 11 QTL for kernel row number (KRN) in three environments, that explained from 9.87 to 19.44% of phenotypic variation in KRN [43]. In the present study, eight CSSLs covering chromosome 2 were identified to detect and validate the genetic effects of qMrdd2 on MRDD. The DSI of CSSL haplotype II harboring qMrdd2.02 differed significantly from that of the susceptible parent Ye478 (P < 0.05) in three environments (Figure.3B and 3C). The consistent results for QTL mapping in our study between RILs and the CSSLs further verify the presence of qMrdd2 in the segment and demonstrate the feasibility of identifying QTL for resistance to diseases using a combination of RILs and CSSLs.

Application of QTL for resistance to MRDD in maize breeding

By using molecular MAS technology, the breeding of maize for MRDD resistance could be accomplished quickly by searching for molecular markers closely linked to the target gene and then screening for maize plants carrying the target fragment. Despite the great successes in identifying QTL for different traits in many different species and identifying the functional genetic variants behind these QTL, the success of molecular MAS has sometimes been limited [44]. When MAS was used to introgress the major QTL qHSR1 for resistance to head smut into 10 smut-susceptible maize inbreds, the head smut resistance of all 10 of these converted inbreds and their hybrids was improved substantially, while other agronomic traits were mostly unchanged [45]. The gibberella stalk rot resistance of elite maize ZmCCT haplotypes without transposable elements in their promoters was enhanced and yield-related traits were also improved, without changes in flowering time [46]. The QTL qMrdd8 from the donor parent X178 was introgressed into seven elite inbred lines from three maize heterotic groups using multi-generation backcrossing and MAS. The seven converted inbred lines and five converted hybrids exhibited enhanced resistance to MRDD across different environments, while other agronomic traits were not affected under non-pathogenic stress conditions [16]. A wheat line carrying the gene for resistance to powdery mildew, Pm21, as donor parent was backcrossed to three spring wheat varieties by combining evaluation for disease resistance with selection using molecular markers. After five backcrosses and four generations of self-pollination, nine converted lines with high resistance to PM and good agronomic traits were developed [47]. As mentioned above, here, the DSI of CSSL haplotype II harboring qMrdd2 significantly differed from that of the susceptible parent Ye478 (P < 0.05) in three different environments (Fig.3B and 3C). This result was consistent with localization qMrdd2 the RIL population and indicated that qMrdd2 could improve resistance to MRDD. Thus, introgression of the MRDD resistance allele at the qMrdd2 locus or the introgression of CSSL haplotype II using linked markers umc1824 and bnlg125 will be useful for improving the MRDD resistance of hybrid maize adapted to growing regions in China.

MRDD has some of the most significant negative economic impacts among diseases affecting maize in China. Most commercially cultivated maize varieties are susceptible to MRDD. So far, breeding maize hybrids for MRDD resistance has efficiently minimized losses caused by MRDD. The qMrdd2 locus has recently been identified as an effective MRDD resistance QTL from Qi319, with an additive effect but no significant dominant gene action for resistance to MRDD, as shown by experiments in multiple environments using 314 RILs. Using advanced backcross and self-pollinated populations derived from CSSLs, we fine-mapped qMrdd2 into a 315-kb interval containing the tightly linked marker RD-26. Meanwhile, the DSI of CSSL haplotype II, which harbors qMrdd2.02, was significantly different from that of the susceptible parent Ye478 or the other CSSLs. The introgression of the MRDD resistance allele at the qMrdd2 locus or CSSL haplotype II using the linked markers umc1824 and bnlg125 into appropriate backgrounds will help reduce MRDD-related maize yield losses. These results provide new insights into the genetic basis of MRDD resistance and have potential value for enhancing maize grain yield.

Plant materials

Plant materials were obtained from the Institute of Crop Science, Chinese Academy of Agricultural Science in China. A RIL population comprised of 314 F₁₁ individuals was developed from a cross between the maize inbred lines Qi319 (MRDD resistant) and Ye478 (MRDD susceptible) by single-seed descent. The MRDD-resistant line Qi319, which belongs to the PB heterotic group was originally developed from the US hybrid 78599, and the MRDD-susceptible line Ye478 was developed from the U8112 × 5003 cross. Using the MRDD-resistant line Qi319 as the donor and the MRDD-susceptible line Ye478 as the recurrent parent, 200 CSSLs were developed using a combination of crossing, selfing, and molecular MAS. Detection of SSR markers was performed as described by Wang et al [48]. The lengths of substituted chromosomal segments were assessed using graphical genotypes [49]. Detailed methods and processes we followed for developing CSSLs were described in a previous study in rice [50]. We characterized the 2 to 4 introgression segments in each CSSL in our study according to the physical positions and genotypes of 201 SSRs. The 201 SSRs were evenly distributed along all 10 maize chromosomes at an average marker interval of 9.94 Mb. Both the parental lines and RILs were evaluated for MRDD resistance in two fields including one in Xinxiang (35.05°N, 113.96°E), Henan Province, China in 2016 and one in Xuzhou (34.79°N, 116.57°E), Jiangsu Province, China in 2015 and 2016. The Xuzhou growing area experiences severe outbreaks maize rough dwarf disease. All of the plant materials including the 314 RILs and two parental lines were arranged in the fields in randomized incomplete blocks with two replications per location. In each block, the parents Qi319 and Ye478 were planted as MRDD-resistant and -susceptible controls, respectively. The plots for each line consisted of approximately 17 plants in individual 4-m rows spaced 0.6 m apart at a planting density of 60,000 plants/ha. Standard agricultural management practices for maize were followed during each growing season at each location.

Evaluation of plants for MRDD symptoms

To evaluate the effects of MRDD, plants were grown in three locations including Xinxiang (35.05°N, 113.96°E) in Henan Province, Xuzhou (34.79°N, 116.57°E) in Jiangsu Province, and Jining in Shandong Province, which allowed MRDD infection of plants to occur under natural conditions. All fields were planted on May 16 each year to coincide with SBPH infestations when RBSDV, which causes MRDD, is transmitted. At the R6 maturity stage, we visually assessed the MRDD resistance of all plants and assigned disease scores on a scale from 0 to 4, in which plants scored 0 are highly resistant and those scored 4 are highly susceptible to MRDD [30]. We defined the DSI [30] as: DSI (%) = S (disease rating score number of plants at each score)/maximum disease rating score total number of plants rated in the line) ´100. The phenotypic data for all plants across different replicates were assessed independently. In order to verify whether plant materials were resistant to virus-free adult planthopper, 100 virus-free adult planthoppers were sealed in boxes with Qi319, Ye478, and F₁ plants at the V3 stage, and the survival rate of virus-free adult planthoppers was assessed daily from the first day to the seventh day (with six plants per box and five replications). Multiple comparisons using Student’s t-test were used to determine whether any differences in mean survival rate for virus-free SBPH were significant.

Linkage map construction and QTL detection

The 314 RILs were genotyped using a GBS approach on an Illumina HiSeq2500 platform. A high-density genetic map was constructed from a total of 88,268 high-quality SNPs with 4183 bin markers. The map of the RIL population comprised a total genetic distance of 1545.65 cM covering all 10 maize chromosomes with an average physical distance between adjacent markers of ~0.51 M. This detailed genetic map has been described in a previous study [39]. Phenotypic data for resistance to MRDD were collected from the population of 314 RILs during field experiments conducted from 2015 to 2016 in Xuzhou and Xinxiang. A linkage map was constructed by inclusive composite interval mapping (ICIM) using QTL IciMapping software 4.0 [51] and analyzed together with phenotypic information to identify QTL for resistance to MRDD. The positive and negative signs of the estimates indicated whether resistance effects for QTL with additive effects were inherited from Ye478 or Qi319, respectively. Taking each location as an environment and for each of the datasets (2015, 2016, and BLUP), the significance threshold for identifying a putative QTL was set at a logarithm of odds (LOD) score > 3 with 1000 permutations at P < 0.05 [51].

Validation of qMrdd2 using the CSSL populations

To validate the effect of qMrdd2, eight CSSLs that covered all of chromosome 2 were developed with Ye478 as the recurrent parent and Qi319 as the donor of the randomized MRDD resistance allele tracked using a combination of crossing, backcrossing and molecular MAS (BC₅F₂) with average background recovery rates from 91.45 % to 99.62 %. In 2015 and 2016, the MRDD resistance of parental lines and CSSL haplotypes I through VIII were evaluated in Xuzhou and Xinxiang. Field designs were arranged in randomized incomplete blocks with three replications per location and the parents Qi319 and Ye478 were planted in each block as resistant and susceptible controls, respectively. Approximately 17 plants from each line were grown in single 4-m rows spaced 0.25 m apart. Student’s t-test was used to perform multiple comparisons for the MRDD resistance of each genotype.

Genotyping and marker development

Genomic DNA was extracted from leaves of plants at the five-leaf stage using a CTAB procedure following the protocol of Murray and Thompson [52] with modifications. The quality and quantity of DNA samples used for marker genotyping was assessed by evaluating DNA samples on 1.0% agarose gels and by measuring absorbances using a spectrophotometer (Nanodrop 2000, Thermo Scientific, US). We obtained the SSR primer sequences for our study from the MaizeGDB (http://www.maizegdb.org/). InDel markers were developed from 30×genome sequence data for the resistant parent Qi319 and susceptible parent Ye478 [39]. These InDels were designated with the prefix RD and screened for polymorphisms between Qi319 and Ye478. SSR or InDel primers used for genotyping of plants were synthesized by AuGCT Biotechnology Co. Ltd., China. Each PCR reaction mixture contained 6.8 µL double-distilled water, 1.2 µL 10× Buffer, 0.5 µL dNTPs (2.5 mM), 0.15 µL each primer (0.01 nmol/µL), 0.2 µL Taq DNA polymerase (5 U/µL), and 1 µL template DNA in a 10-µL total volume. The touchdown PCR program for amplifying these markers included an initial denaturing step at 94 °C for 4 min, followed by 10 cycles of 30 s at 95 °C, 30 s at 65 °C, and 30 s at 72 °C, with the annealing temperature decreasing by 1 °C per cycle; followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C, and 30 s at 72 °C; and ending by extending for 5 min at 72 °C. The PCR products were then electrophoretically separated on 8% polyacrylamide gels in 1× TBE buffer that were then silver stained for visualization of PCR products.

Fine-mapping of qMrdd2

We carried out the recombinant-derived progeny tests to fine-map qMrdd2 (Fig. 1) [53]. Based on the QTL region mapped using RILs and CSSLs, CSSL-31 (haplotype II) was crossed as a male parent with Ye478 to produce an F₁ in Yunnan in 2015. The 25 F₁progeny were then self-pollinated to produce the F₂and crossed with Ye478 to produce the BC₁F₁ in a winter nursery in Hainan in 2015. In the summer of 2016, 850 F₂ and 1000 BC₁F₁ were genotyped, and new recombinants mapped within the region containing the QTL were self-pollinated to produce F₃ and BC₁F₂ progenies at Jining and Xinxiang under natural infection conditions. In the winter of 2016, 6000 F₃ and 6000 BC₁F₂ progeny were planted in the winter nursery and screened for new recombinants. F₃ and BC₁F₂recombinants with a homozygous Qi319 genotype at the flanking marker on one side and a homozygous Ye478 genotype of on the other side were then selfed. At the same time, we selfed the heterozygous recombinant BC₁F₂ progenies to produce segregating BC₁F₃ populations heterozygous at the flanking marker on one side and homozygous at the flanking marker on the other side. BC₁F₃ recombinants and F₃ recombinants were then classified into different haplotypes by developing markers. These segregating populations and homozygous recombinants were then used to fine map qMrdd2.

In the summer of 2017, we detected differences in DSI under natural infection in Jining, Xinxiang, and Xuzhou between the homozygous families derived from recombinants and Ye478 using Student’s t-test in SAS version 9.2. DSIs differing significantly (P < 0.05) between homozygous recombinant-derived families and Ye478 indicated that qMrdd2 was located within a homozygous Qi319/Qi319 segment, whereas DSIs differing insignificantly (P ≥ 0.05) indicated that qMrdd2 was located within a homozygous Ye478/Ye478 segment. Each homozygous recombinant and Ye478 were grown in plots of approximately 17 plants in 4-m rows spaced 0.6 m apart with three replications per location. At the same time, 150-300 kernels randomly selected from each plot representing the progeny of diverse types of BC₁F₂ recombinants were planted to evaluate for MRDD resistance under natural inoculation conditions in Jining, Xinxiang, and Xuzhou. Each BC₁F₂ recombinant could be categorized as carrying one of two possible segments, heterozygous Qi319/Ye478 or homozygous Qi319/Qi319, flanking the recombination breakpoint. Individuals from the selfed BC₁F₂recombinant progeny were categorized into one of three possible genotypes in the qMrdd2 region: homozygous Qi319/Qi319, homozygous Ye478/Ye478, or heterozygous Qi319/Ye478. One-way ANOVA was used to compare the DSIs of these three genotypic classes in SAS version 9.2 (SAS Inc., Cary, NC, US, 2009). The DSIs of the three genotypic classes differing significantly (P < 0.05) indicated that the MRDD resistance gene was located within a heterozygous region, whereas the DSIs of three genotypic classes differing insignificantly (P ≥ 0.05) indicated that the MRDD resistance gene was located within a homozygous segment.

Analysis of phenotypic data

As described above, the disease response phenotypes of all recombinant-derived progenies were assessed in terms of DSI (See above for calculation of DSI). All of the genotypic and phenotypic datasets were calculated using Microsoft Excel 2010 software. We estimated the broad-sense heritability (H²) of MRDD resistance across three environments according to Knapp et al. [54]. We calculated heritability as: H² = δ²_g/(δ²_g + δ²_ge /e + δ²/er), where δ²_g is the genetic variance, δ²_ge is the genotype × environment interaction, δ² is error variance, e is the number of environments, and r is the number of replications per environment. The estimates for δ²_g, δ²_ge, and δ² were calculated with analysis of variance (ANOVA) using PROC MLM, the Mixed Linear Model procedure, in Statistical Analysis System (SAS) software version 9.2 [SAS Inc., Cary, NC, US, 2009].

DSI: Disease severity index

Mb: Megabase pairs

MRDD: Maize rough dwarf disease

PCR: Polymerase chain reaction

QTL: Quantitative trait loci

RIL: Recombinant inbred line

SSR: Simple sequence repeats

InDel: insertion-deletion

CSSL: Chromosome segment substitution line

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

All of datasets supporting the conclusions of this article are included within the article. The maize reference genome datasets used during the current study are obtained from the maizeGDB database (https://www.maizegdb.org/).

Competing interests

The authors declare that they have no competing interests.

Funding

This study was financially supported by the National Natural Science Foundation of China (31771804) and the China Academy of Agricultural Sciences Innovation Project.

Authors' contributions

ZNX wrote the draft manuscript, carried out molecular genetic studies, performed statistical analyses and participated in phenotypic evaluations. ZQZ, CLL, ZFH, MSL, DGZ, and JNH helped with the development and genotyping of the RIL population. FFW, QCM, YPC, SGT, and XHH performed the maize field cultivation and pollination, as well as phenotypic evaluations. XHL, ZHW, and JFW supervised the research, designed the experiments, and were involved in data analysis. All authors have read and approved the final manuscript.

Acknowledgements

We thank Dr. Chaoshu Zhang of the Northeast Agricultural University for her help in sample collection. We also thank Dr. Yu Zhou from Northeast Agricultural University for revising and improving the English language of the manuscript.

Harpaz I. Needle transmission of a new maize virus. Nature. 1959;184(4688):77–78.
Huth W, Maurath R, Imgraben H, Schroder M. Maize rough dwarf virus for the first time detected in Germany. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes. 2007;59(8):173–175.
Di Renzo MA, Bonamico NC, DÍaz DD, Salerno JC, Ibañez MM, Gesumaria JJ. Inheritance of resistance to Mal de Río Cuarto (MRC) disease in Zea mays (L.) J Agric Sci. 2002;139(01):47–53.
Dovas CI, Eythymiou K, Katis NI. First report of maize rough dwarf virus (MRDV) on maize crops in Greece. Plant Pathol. 2004;53(2):238–238.
Tao YF, Liu QC, Xu ML. The research progress on maize rough dwarf disease. J Maize Sci. 2013;21(1):149–152.
Milne RG, Lovisolo O. Maize rough dwarf and related viruses. Adv Virus Res. 1977;21:267–341.
Dovas CI, Eythymiou K, Katis NI. First report of maize rough dwarf virus (MRDV) on maize crops in Greece. Plant Pathol. 2004; 53:238.
Arneodo JD, Guzman FA, Conci LR, Laguna IG, Truol GA. Transmission features of Mal de Rio Cuarto virus in wheat by its planthopper vector Delphacodes kuscheli. Ann Appl Biol. 2002; 141:195–200.
Fang S, Yu J, Feng J, Han C, Li D, Liu Y. Identification of rice black-streaked dwarf fijivirus in maize with rough dwarf disease in China. Arch. Virol. 2001;146:167–170.
Wang Q, Tao T, Han YH, Chen XR, Fan ZF, Li DW, Yu JL, Han CG. Nonstructural protein P7-2 encoded by Rice black-streaked dwarf virus interacts with SKP1, a core subunit of SCF ubiquitin ligase. Virology J. 2013;10:325–336.
Caciagli P, Casetta A. Maize rough dwarf virus (Reoviridae) in its planthopper vector Laodelphax striatellus in relation to vector infectivity. Ann Appl Biol. 1986;109(2):337–344.
Wang AL, Wang JJ, Chen CH. Study on maize rough dwarf virus incidence law and its integrated control technique. J Maize Sci. 2005;13(4):114–116.
Zhang H, Chen J, Lei J, Adams MJ. Sequence analysis shows that a dwarfing disease on rice, wheat and maize in China is caused by Rice black-streaked dwarf virus. Eur J Plant Pathol. 2001;107:563–567.
Bai FW, Yan J, Qu ZC, Zhang HW, Xu J, Ye MM, Shen D. Phylogenetic analysis reveals that a dwarfing disease on different cereal crop in China is due to rice black streaked dwarf virus (RBSDV). Virus Genes. 2002;25:201–206.
March GJ, Ornaghi JA, Beviacqua JE, Giuggia J, Rago A, Lenardon SL. Systemic insecticides for control of Delphacodes kuscheli and the Mal de Río Cuarto virus on maize. Int J Pest Manag. 2002;48:127–132.
Xu ZN, Hua JG, Wang FF, Cheng ZX, Meng QC, Chen YP, Han XH, Tie SG, Liu CL, Li XH, Wang ZH, Weng JF. Marker-assisted selection of qMrdd8 to improve maize resistance to rough dwarf disease. Breeding Sci. 2019;
Ye XG, Zhang SX, Li SJ, Wang J, Chen HQ, Wang K, Lin ZJ, Wei YQ, Du LP, Yan YM, Improvement of three commercial spring wheat varieties for powdery mildew resistance by marker-assisted selection. Crop Prot. 2019;125.
Castonguay Y, Dube MP, Cloutier J, Bertrand A, Michaud R, Laberge S. Molecular physiology and breeding at the crossroads of cold hardiness improvement. BMC Plant Biol. 2013;1:64–74.
Lu YG, Di DP, Miao HQ, Tian LZ. Identification and analysis on resistance of introduced foreign and domestic maize inbreds to MRDV. J Hebei Agric Sci. 2001; 5:22–24 (in Chinese).
Yang XF, Wen GB, Yang Y. Resistance identification and analysis of different maize germplasm to maize rough dwarf virus. J Maize Sci. 2010; 18:144–146 (in Chinese).
Xue L, Zhang D, Xu L, Jin MM, Peng CJ, Xu CW. Mining and analyzing genetic diversity for maize rough dwarf disease resistant germplasms and its application in maize breeding. Acta Agron Sin. 2012; 37:2123–2129 (in Chinese).
Liu CL, Hao ZF, Zhang DG, Xie CX, Li MS, Yong HJ, Zhang SH, Weng JF, Li XH. Genetic properties of 240 maize inbred lines and identity-by-descent segments revealed by high-density SNP markers. Mol Breed. 2015;35:146.
Liu ZZ, Chi SM: Resistance of corn genotypes to maize rough dwarf virus. J Maize Sci. 1996; 4:68–70.
Bonamico NC, Di Renzo MA, IbaÑEz MA, Borghi ML, Díaz DG, Salerno JC, Balzarini MG. QTL analysis of resistance to Mal de Río Cuarto disease in maize using recombinant inbred lines. J Agric Sci. 2012; 150:619–629.
Di Renzo MA, Bonamico NC, Díaz DG, IbaÑEz MA, Faricelli ME, Balzarini MG, Salerno JC. Microsatellite markers linked to QTL for resistance to Mal de Río Cuarto disease in Zea mays L. J Agric Sci. 2004; 142:289–295.
Wang F. Molecular mapping of three loci conferring resistance to maize (Zea mays L.) rough dwarf disease. Doctoral Dissertation: Shandong University. 2007 (in Chinese)
Luan J, Wang F, Li Y, Zhang B, Zhang J. Mapping quantitative trait loci conferring resistance to rice black-streaked virus in maize (Zea mays L.). Theor Appl Genet. 2012;125:781–791.
Shi LY, Hao ZF, Weng JF, Xie CX, Liu CL, Zhang DG, Li MS, Bai L, Li XH, Zhang SH. Identification of a major quantitative trait locus for resistance to maize rough dwarf virus in a Chinese maize inbred line X178 using a linkage map based on 514 gene-derived single nucleotide polymorphisms. Mol Breed. 2012;30:615–625.
Tao YF, Liu QC, Wang HH, Zhang YJ, Huang XY, Wang BB, Lai JS, Ye JR, Liu BS, Xu ML. Identification and fine-mapping of a QTL, qMrdd1, that confers recessive resistance to maize rough dwarf disease. BMC Plant Biol. 2013;13:145.
Liu CL, Hua JG, Liu C, Zhang DG, Hao ZF, Yong HJ, Xie CX, Li MS, Zhang SH, Weng JF, Li XH. Fine mapping of a quantitative trait locus conferring resistance to maize rough dwarf disease. Theor Appl Genet. 2016;129(12):2333–2342.
Holland JB. Genetic architecture of complex traits in plants. Curr Opin Plant Biol. 2007;10:156–161.
Yin D, Zhu X, Jiang L, Zhang J, Zeng Y, Wu R. A reciprocal cross design to map the genetic architecture of complex traits in apomictic plants. New Phytol. 2015;205(3):1360–1367.
Fraser RSS. The genetics of resistance to plant viruses. Annu Rev of Phytopathol. 1990;28:179–200.
Gómez P, Rodríguez-Hernández AM, Moury B, Aranda MA. Genetic resistance for the sustainable control of plant virus diseases: breeding, mechanisms and durability. Eur J Plant Pathol. 2009;125(1):1–22.
Orban L, Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, et al. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS One. 2011;6(5):e19379.
Salvi S, Corneti S, Bellotti M, Carraro N, Sanguineti MC, Castelletti S, et al. Genetic dissection of maize phenology using an intraspecific introgression library. BMC Plant Biol. 2011;11(1):4.
Chen ZL, Wang BB, Dong XM, Liu H, Ren LH, Chen J, et al. An ultra-high density bin-map for rapid QTL mapping for tassel and ear architecture in a large F2 maize population. BMC Genomics. 2014;15:433.
Li CH, Li YX, Bradbury PJ, Wu X, Shi YS, Song YC. Construction of high-quality recombination maps with low-coverage genomic sequencing for joint linkage analysis in maize. BMC Biol. 2015;13:78–90.
Zhou ZQ, Zhang CS, Zhou Y, Hao ZF, Wang ZH, Zeng X, Di H, Li MS, Zhang DG, Yong HJ, Weng JF, Li XH. Genetic dissection of maize plant architecture with an ultra-high density bin map based on recombinant inbred lines. BMC Genomics. 2016;17:178–190.
Yuan L, Ding D, Li WH, Xie HL, Tang JH, Fu ZY. Construction of single segment substitution lines (SSSLs) of the elite inbred lines in maize (in Chinese). J Maize Sci. 2012;20:52–55.
Wang ZQ, Yu CY, Liu X, Liu SJ, Yin CB, Liu LL, Lei JG, Jiang L, Yang C, Chen LM , Zhai HQ , Wan JM. Identification of Indica rice chromosome segments for the improvement of Japonica inbreds and hybrids. Theor Appl Genet. 2012; 124:1351–1364.
Yang HY, Wang WB, He QY, Xiang SH, Tian D, Zhao TJ, Gai JY. Identifying a wild allele conferring small seed size, high protein content and low oil content using chromosome segment substitution lines in soybean. Theor Appl Genet. 2019;132(10): 2793–2807.
Li F, Jia HT, Liu L, Zhang CX, Liu ZJ, Zhang ZX. Quantitative trait loci mapping for kernel row number using chromosome segment substitution lines in maize. Genet Mol Res. 2014;13:1707–1716.
Collard BC, Mackill DJ. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Phil Trans R Soc Lond B. 2008;363:557–572.
Zhao XR, Tan GQ, Xing YX, Wei L, Chao Q, Zuo WL, Lübberstedt T, Xu ML. Marker-assisted introgression of qHSR1 to improve maize resistance to head smut. Mol. Breeding. 2012;30:1077–1088.
Li YP, Tong LX, Deng LL, Liu QY, Xing YX, Wang C, Liu BS, Yang XH, Xu ML. Evaluation of ZmCCT haplotypes for genetic improvement of maize hybrids. Theor Appl Genet. 2017;130:2587–2600.
Ye XG, Zhang SX, Li SJ, Wang J, Chen HQ, Lin ZS, Wei YQ, Du LP, Yan YM. Improvement of three commercial spring wheat varieties for powdery mildew resistance by marker-assisted selection. Crop Prot. 2019;125–139.
Wang BT, Shen CT, Zhang JZ, Li XH, Xi ZY. Study of a micro-PCR reaction system in maize. J Maize Sci. 2009;17(4):29–31 (in Chinese with English abstract).
Young ND, Tanksley SD. Restriction fragment length polymorphism maps and the concept of graphical genotypes. Theor Appl Genet. 1989;77(1):95–101.
Zhu WY, Lin J, Yang DW, Zhao L, Zhang YD, Zhu Z, Chen T, Wang CL. Development of chromosome segment substitution lines derived from backcross between two sequenced rice cultivars, Indica recipient 93-11 and Japonica donor Nipponbare. Plant Mol Biol Rep. 2009; 27(2):126–131.
Meng L, Li H, Zhang L, Wang J. QTL IciMapping: integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015;3:269–283.52. Doerge RW, Churchill GA. Permutation tests for multiple loci affecting a quantitative character. Genetics. 1996;142:285–294.
Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research, 1980;8:4321–4326.
Yang Q, Zhang DF, Xu ML. A sequential quantitative trait locus fine-mapping strategy using recombinant-derived progeny. J Integr Plant Biol. 2012;54(4):228–237.
Knapp SJ, Stroup WW, Ross WM. Exact confidence intervals for heritability on a progeny mean basis. Crop Sci. 1985;25(1):192–194.

Table 1 Phenotypes of the parental lines and RILs across three environments

Year	Qi319	Ye478	RILs
	Mean (%)	Mean (%)	Mean ±SD^a(%)	Range (%)	Skewness	Kurtosis	CV^b (%)	Heritability (%)
E1	11.47 ±2.68	52.08 ± 3.26	56.36 ± 5.36	20 - 86	0.0891	0.7762	10.26	76.98
E2	15.62 ±3.12	80.31 ± 4.15	45.98 ± 6.35	12 - 79	-0.0741	0.8736	8.95	80.12
E3	13.67 ±2.49	86.67 ± 5.67	61.35 ± 6.78	13 - 90	0.0871	0.9531	9.16	81.67
Combined	13.75 ±2.27	71.35 ± 4.98	55.36 ± 6.12	15 - 88	0.0764	0.8561	9.75	80.64

^a SD, standard deviation;

^bCV, coefficient of variation;

E1: 2015 in Xuzhou, Jiangsu Province

E2: 2016 in Xuzhou, Jiangsu Province

E3: 2016 in Xinxiang, Henan Province.

Table 2 Mapping of the QTL for MRDD resistance, qMrdd2, using RILs from a cross between Qi319 and Ye478

Field trial	QTL ^a	Bin ^b	Flanking marker ^c	Marker interval ^d(Mb)	LOD ^e	PVE ^f (%)	Add. ^g	SRA
Field trial	QTL ^a	Bin ^b	Flanking marker ^c	Marker interval ^d(Mb)	LOD ^e	PVE ^f (%)	Add. ^g	SRA
E1^h	qMrdd2	2.02	MK806-MK811	11.35-12.0	5.83	8.17	-4.53	Qi319
E2^h	qMrdd2	2.02	MK807-MK808	11.45-11.6	5.96	8.64	-4.65	Qi319
E3^h	qMrdd2	2.02	MK807-MK808	11.45-11.6	7.93	11.02	-4.50	Qi319
BLUP	qMrdd2	2.02	MK807-MK811	11.45-12.0	7.36	10.68	-4.58	Qi319

^a The name of each QTL is a composite of the influenced trait, maize rough dwarf disease

^b Chromosome bin location of QTL

^c Markers to the left and right of the QTL

^d Interval between the two markers on the B73 reference genome RefGen_v3sequence.

^e The logarithm of odds score

^fPhenotypic variance explained by individual QTL

^gAdditive effect value

^h E1: 2015 in Xuzhou, Jiangsu Province

E2: 2016 in Xuzhou, Jiangsu Province

E3: 2016 in Xinxiang, Henan Province

Table 3 Primers developed for fine-mapping qMrdd2

maker	Position (bp)	Forward primer (5'-3')	Reverse primer (5'-3')	Type
umc1824a	7.411.594	ATCGTGCTTAAGCGGTTATAGGAAT	TGCACATGCTTTGTATAAGATGCC	SSR
RD-33	8.283.417	AAAGGCAGCGATGGGTGAT	CTGGTGGAGTGTTGTTATGG	InDel
RD-28	9.418.302	GCGACTGAAAGGAACCACTG	CTGCTCTGAACATTCCGATG	InDel
RD-42	10.478.148	GTGACTGACAGGACGAGGCT	GGATTCAGGCAACGACCAA	InDel
RD-97	10.661.704	ACGTCACATGAAGGTGGTGGA	CAATCGCTAGGCTGCTGGTAG	InDel
RD-3	11.318.029	TGAAGTGACACCCCTAAACC	GGAGGAGCACCAGAACAAAT	InDel
RD-52	11.943771	ATCACTTTATTTTGCTCTTCAG	GCAGTTCCAGCCTCATCCTAC	InDel
RD-56	12.143699	TCAGACCTAACGACCTGTTGT	TACGAGCTTGAATCATCATTG	InDel
RD-81	12.260.380	ATTGCTTGCTCGCTCGCTTTG	GCTAGGGGCGGAGGACCAGAT	InDel
RD-26	12.354.844	CCAGGAGGCGGTAACGCTA	AGAGCGAGGACTCACTGTCCG	InDel
RD-87	12.575.608	GAGCCAACAGTTTGTCATCTT	CCTGTCTTACTATACTGCCTGA	InDel
RD-114	12.685.280	ATCGCATCCATCCAAATCACA	TCCTGCACCTCAATCGCCTA	InDel
RD-93	12.805.802	CACAAGACGACGGATGATACAA	TAGCGGAAGTGAGTACAAGGT	InDel
RD-20	13.303.791	AGGATTCCAACACGGAAAA	TAACGCATACAGCGCACAT	InDel
bnlg125	13.602.840	GGGACAAAAGAAGAAGCAGAG	GAAATGGGACAGAGACAGACAAT	SSR

Primer positions are according to B73 RefGen_v3.

Table 4 Comparison of the MRDD resistance of CSSL haplotypes to the control line Ye478

CSSL	Target region	Background recovery rate (%)	DSI (%)			Bin	Linked marker
CSSL	Target region	Background recovery rate (%)	2015-Xuzhou	2016-Xuzhou	2016-Jining	Bin	Linked marker
Haplotype I	＋/＋	99.21	55.00	68.41	68.48	Bin2.01	bnlg1338
Haplotype II	＋/＋	98.75	20.01*	56.73*	51.71*	Bin2.02	umc1824-bnlg125
Haplotype III	＋/＋	99.25	54.41	69.64 *	61.80	Bin2.06	umc2178
Haplotype IV	＋/＋	99.51	75.83	76.43	59.63*	Bin2.06-2.07	umc2178-umc1637
Haplotype V	＋/＋	99.62	60.92	87.50	81.92	Bin2.07	umc1637-bnlg1267
Haplotype VI	＋/＋	91.61	49.76	75.00	89.65	Bin2.07	bnlg1267-bnlg2077
Haplotype VII	＋/＋	91.45	50.00	81.25	87.06	Bin2.08	umc2202
Haplotype VIII	＋/＋	99.45	48.68	82.60	87.30	Bin2.09	bnlg1520
Ye478	－/－		52.08	80.31	86.67

“＋/＋”: The target region is a homozygous allele of Qi319 (R); “－/－”: The target region is a homozygous allele of Ye478 (S). Recurrent parent Ye478 (S) was used as the control line for resistance evaluation. “*” Significant at P < 0.05.

Download PDF

Version 1

posted 23 Jan, 2020

You are reading this latest preprint version

Fine-mapping the recently discovered QTL qMrdd2 that confers resistance to maize rough dwarf disease

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusions

Methods

Abbreviations

Declarations

References

Tables

Status:

Version 1