Seed preparation of target plant
First, the seeds of the melon plant were prepared through washing it to remove any kind of contamination. The seeds were then dried indirectly using sunlight and the kernels were separated and crushed using a grinder. The resulting powder was used as a starting material to purify the target peptides by chromatography.
Preparation of affinity column with trypsin ligand and chromatography
After preparation of the specified seed powder, the chromatography method was done as previously described elsewhere (25). Only, in the last step, the supernatant was loaded onto the column, and therefore the column was washed with deionized water until the absorbance of fractions at 280 nm came to zero. Three column volumes of deionized water with PH=2.5 accustomed to wash sure proteins from the column (deionized water was adjusted to PH=1.5 with 0.1 N HCl).
Polyacrylamide gel electrophoresis
Polyacrylamide gel electrophoresis was performed in the presence of sodium dodecyl sulfate SDS-PAGE based on the Schagger and Von Jagow method (26) as previously explained (25).
Measurement of protein concentration
The final and quantitative protein concentrations were determined by the Bradford method as the standard procedure (27).
Assay of TI activity
The activity of the Trypsin inhibitor from Cucumis melo (Muskmelon) was determined by the residual trypsin activity following the method of Hajela (28) with slight modifications using N-α-benzoyl-DL-arginine-pnitroanilide (BApNA) as the substrate and bovine trypsin as the standard enzyme. The reaction mixture containing 50 μl TI (5 mg/ml), 50 μl trypsin (1 mg in 5 mL of 0.05 M Tris-HCl, pH 8.0, containing 0.03 M CaCl2) and 100 μl 0.05 M Tris-HCl (pH 8.0) containing 0.03 M CaCl2 was incubated at 37 °C for 10 min in a shaking water bath. The residual activity was measured by adding 1 mL of 0.8 mM BApNA (7 mg dissolved in a minimum volume of DMSO and adjusting its final volume to 20 mL with 0.05 M Tris-HCl, pH=8.0, containing 0.03 M CaCl2) to the reaction mixture followed by incubation at 37 ºC for 10 min in a shaking water bath. The reaction was stopped by adding 20 μl of 30% (v/v) glacial acetic acid. A blank and a trypsin control were run simultaneously. In blank, acetic acid was added prior to the addition of BApNA and in trypsin control, distilled water was added in place of the TI. The absorbance was recorded at 410 nm against the blank using a double beam UV-visible spectrophotometer (Model 2202, Systronics, India). An appropriate volume of the kidney bean extract, which was enough to give 40-60% inhibition of trypsin, was taken for the assay. One trypsin unit (TU) was defined as an increase of 0.01 absorbance units at 410 nm per 1.2 mL of the reaction mixture. TI activity was expressed as the number of trypsin units inhibited (TUI).
In-vitro phase
Cell line and culture conditions
MC4-L2 mouse breast cancer cell lines (National Center for Genetic and Biological Resources of Iran, Tehran) were maintained and grown in 25 and 75 cm2 flasks (SPL, Pocheon, Korea) in DMEM: Ham´s F12 + 2 mM L-Glutamine + 15 mM HEPES buffer, penicillin (100 µg/ml), streptomycin (100 µg/ml), and 10% (vol/vol) fetal bovine serum (FBS, Gibco BRL, Life Technologies, Grand Island, NY) in a 37°C incubator and 5% CO2. Cells were monitored by a phase‐contrast microscope until they reached appropriate confluence. Once the cells reached 90% confluency, the MC4-L2 cells was harvested with 0.25% trypsin–0.02% ethylenediaminetetraacetic acid (EDTA). Cell viability and numbers were determined by a hemocytometer and trypan blue exclusion. Cell viability was calculated to be greater than 98%.
Cell viability assay in vitro
Toxicity and cell proliferation were assessed using the MTT Sigma test. First, to determine and set up the exact number of cells required to perform the desired test in a 96-'s pellet in 8 rows of 12 wells, different values of 5 * 103, 10 * 103, 15 * 103, 20 * 103, 25 * 103, 30 * 103, 50 * 103 and 100 * 103 of MC4-L2 sol were poured into 10% FBS-enriched DMEM-F12 medium to evaluate cell growth. After 24 hours, the cell growth rate was examined using a microscope and the number of 104 cells per well of the pellet had the best response, which was selected as the number of cells approved for MTT testing. To perform the MTT test, 104 cells of MC4-L2 cell line were poured into each of 96 culture pellets and then 10% FBS enriched with 100 ml of DMEM-F12 culture medium per 100 ml was added. After 24 hours of incubation at 37 ° C with 5% CO2, different concentrations of TI (5, 10, 25, 50, 100, 200, 300, 400, 800, 1200 µg/ml), EXT (5, 10, 25, 50, 100, 200, 400, 800, 1200 µg/ml) and, TAM (0.01, 0.1, 1, 5, 10, 15, 20 µmoll) were added to each well and then 100 ml of the desired culture medium was added. The cells were incubated again for 48 hours and these steps were repeated 3 times for all concentrations. After 48 hours of incubation at 37° C with 5% CO2, equivalent to 10 microliters of 3- (4,5-dimethylthiazole-2) -2,5-diphenyltetrazolium bromide MTT solution (Sigma) (0.5 mg/ml MTT powder in PBS), was added to each of the culture medium houses and incubated again for 4 hours at 37 ° C with 5% CO2 and then centrifuged at 3000 rpm for 10 minutes. To dissolve the Formazan crystal, the supernatant containing MMT was completely removed and 200 ml of dimethyl sulfoxide (DMSO) was added to each well and kept at room temperature for 30 minutes to dissolve completely. The ELISA reader was read at 570 nm and 630 nm.
Examination of anti-angiogenesis effects of TI, EXT, and TAM
According to MTT results and after preparation of the MC4-L2 cell line, 104 cells were poured into each well of a 96-well plate and placed in an incubator for 24 hours. Then we emptied the medium on the wells and 500 μl of fresh medium with 10% FBS was added to the wells. The Control group received no treatment. Treatments groups were designed as BPS solution, 5 µmoll of TAM, 400 μg / ml of EXT, TI at concentrations of 200 and 300 μg/ml, and 300 μg/ml of TI + 5 µmoll of TAM. Then the plates were incubated at a CO2 incubator for 72 h. Treatments were carried out in five for each dose. Finally, the anti-angiogenesis effects were examined using fluorescent staining and the RT-PCR method.
Fluorescent staining method and viability test
PBS 1X solution, FDA (Fluorescein Diacetate) and, PI (Propidium Iodide) were used in a proportion of 1 ml, 10 µl, and 100 µl, respectively. Images were recorded using a microscope camera (Fig 1).
Animal Phase
Experimental animals and tumor model
The Ethics Committee at Shiraz University of Medical Sciences approved the experiments (IR.SUMS.REC.1398.950). Five to six weeks‐old normal female BALB/c inbreed female mice were purchased from Pasteur Institute (Tehran, Iran). The mice were housed in an animal facility at a temperature of 22 -24°C and 65% humidity. Trypsinized MC4-L2 cells were then harvested and washed to induce tumor formation in the mice. Their concentration was adjusted to 3.5 × 106 cells/100 μl with phosphate‐buffered saline (PBS) at less than 98% viability. Prepared cells were injected subcutaneously into the right upper thigh of each mouse. Approximately 7–10 days after injection of the cancer cells, the tumors were palpated in the injected areas. The BALB/c inbreed mice were randomly devided into six groups of five mice per group: controlled breast cancer mice without any treatment (normal control group), breast cancer mice treated with either 300 µgr/ml or 600 µgr/ml of TI, breast cancer mice treated with 800 µgr/ml of EXT, breast cancer mice group received 10 µmol TAM and the last group was breast cancer mice that received combination therapy of 600 µgr/ml of TI + 10 µmol TAM. The treatment period duration was 14 days. Finally, the mice were first anesthetized and then killed, and their tumor tissue was extracted and stored in 10% formalin.
Histological assessments
Tissue passage steps, preparation of paraffin blocks, and preparation of 5-micron sections were performed. H&E staining method was performed for histological assessments using undiluted Mayer's hematoxylin (Merck, Darmstadt, Germany) and 0.5% eosin (Merck). Evaluations were performed by light microscope (Olympus cx31) for the intensity and scoring of inflammation (--, -/+, and +/+), necrosis (%), and peripheral vessels as angiogenesis (+, ++, +++) (Fig 2).
Molecular phase
RNA extraction and cDNA synthesis
Total RNA extraction was extracted from MC4-L2 cell line-treated and tumor tissues of mice using TRIZOL reagent (Gene All, South Korea), according to the manufacturer’s instructions. RNA concentrations were determined using the NanoDrop spectrophotometer (Thermo Scientific, Germany). The quality of extracted RNA was assessed by 1% agarose gel electrophoresis. After RNA extraction, the complementary DNA (cDNAs) were synthesized using a cDNA synthesis kit (EURx, Poland), according to the manufacturer’s instructions.
Quantitative real-time polymerase chain reaction
Real-time polymerase chain reaction (PCR) was used to determine the expression levels of MMP-2, MMP-9, and VEGF genes in the MC4-L2 cell line and tumor tissue of mice.
Designing of primers used for RT-PCR were done by Allele ID 6 software and are listed in Table 1. Subsequently, the primer specificity was confirmed by Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast) and In-Silico PCR (https://genome.ucsc.edu/cgi-bin/hgPcr. The human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was considered as the housekeeping gene (internal control).
The real-time PCR reactions were performed in duplicates using the SYBR Green PCR master kit (EURx, Poland) in a real-time PCR instrument (Applied Biosystems, USA). The expression of interested genes (MMP-2, MMP-9, and VEGF) at transcript level were normalized to the GAPDH gene expression, and the standard deviations were calculated. Relative real-time PCR was performed in duplicates, and each experiment was repeated two times. The program for thermocycling was as follows: 1 cycle at 95°C for 2 min, followed by 40 cycles at 95°C for 30 seconds, and then 1 cycle at 65°C for 20 seconds. Finally, the relative quantification of the gene expression was achieved using the comparative Ct method (29).
Table 1: Nucleotide sequences of the primers used for the gene expression analysis by real-time PCR.
Aneling temperature
|
Oligo Sequence 5'--> 3'
|
Gene
|
59
|
Forward primer TGATGGCATCGCTCAGATCC
Reverse primer TGTCACGTGGTGTCACTGTC
|
MMP-2 primers
|
59
|
Forward Primer CGCTCATGTACCCGCTGTAT
Revers Primer GCCTTGGGTCAGGCTTAGAG
|
MMP-9 primers
|
58
|
Forward Primer CTGGAAGAATCGGGAGCCTG
Revers Primer ACCACCGTGTCTTCTCTTGC
|
VEGFa primers
|
59
|
Forward Primer ACTGAGCAAGAGAGGCCCTA
Revers Primer TATGGGGGTCTGGGATGGAA
|
GAPDH
|
Statistical analyses
Normal distribution of data on histopathological factors and tumor characteristics was assessed using the Kruskal-Wallis test. The statistical differences in the expression levels of genes and the fold changes in treated and control groups were compared using the Livak method (2-ΔΔCT). One-way ANOVA was used for other parameters with LSD as the post-hoc test. Statistical analyses were performed using SPSS software (version 22.0; IBM Corporation, Armonk, NY, USA). The results were considered to be significant when the P-values were<0.05.