DOI: https://doi.org/10.21203/rs.2.21814/v1
Background: As a widespread health pest, flies can carry more than 100 kinds of pathogenic microbes to threat human health, resulting in a wide range of disease infection and transmission. The aim of this study was to develop a sensitive, reliable and rapid method for the simultaneous detection of multiple fly-borne bacterial pathogenic microorganisms, in order to effectively prevent and control fly-borne bacterial diseases.
Results: PCR-RLB method could directly and accurately detect fly-borne bacteria species corresponding of 7 species-specific probes. At the same time, the membrane binding oligonucleotide species-specific probes prepared in RLB detection technology can be reused for detection of bacteria after washing with 0.5 M EDTA, which greatly improves the detection efficiency. In 106 groups of samples, the numbers of samples carrying seven different bacterial strains were 2 (S. aureus), 52 (S. flexneri), 0 (A. caviae), 3% (V. vulnificus), 56 (S. enterica), 1 (P. vulgaris) and 33 (Y. enterocolitica), respectively. Their proportions of 7 bacterial strains carried by houseflies were 1.23% (S. aureus), 32.1% (S. flexneri), 0% (A. caviae), 1.85% (V. vulnificus), 34.57% (S. enterica), 0.62% (P. vulgaris) and 20.37% (Y. enterocolitica), respectively. It was found that the worse the hygienic condition, the higher the bacteria carrying rate of houseflies was. S. enterica, S. flexneri and Y. enterocolitica accounted for the overwhelming majority of the seven pathogenic strains carried by houseflies from four different environments in Lanzhou. This indicated that houseflies played an important role in the transmission of intestinal diseases, which was mainly related to the breeding and reproduction of houseflies in feces, carrion and food. S. aureus was carried by houseflies in the hospital area indicates that hospitals should do well in killing and controlling flies and further strengthen the prevention and control of fly-borne bacterial diseases.
Conclusion: The RLB assay appeared to have potential clinical application in the simultaneous detection of fly-borne bacterial species.
As an important vector for insect-vector diseases, flies carry or disseminate a variety of bacterial pathogenic microorganisms to cause human diarrhea, food poisoning and various bacterial diseases such as cholera, bacteremia, tuberculosis, anthrax, and the like [1–8]. There are a wide variety of flies, among which only a few species are the most common in the human family and around the farm, including housefly, stomoxys calcitrans, lucilia sericata, sarcophagidae and so on. Flies feed and reproduce in animal feces, organic wastes and carcasses, being one of the important threats to human health [9–18]. On February 24, 2005, the Science Times reported that flies spread of Enterohemorrhagic E. coli and avian influenza in Japanese. In China, flies are also included in the key prevention and control target of insect-borne diseases.
Insect-borne bacterial disease detection is mainly based on traditional bacterial culture and isolation. Identification of each strain takes at least a week or so. This method is time and labor-consuming and has strict requirements on the laboratory environment, which leads to the isolation and cultivation of bacteria cannot be carried out in areas without large laboratories, and seriously affect the prevention and treatment of insect-borne diseases. The rapid and efficient detection of insect-borne bacterial diseases has become a hot field in the prevention and control of insect-borne diseases. Reverse line blot (RLB) is a sensitive and high-throughput detection method, which can simultaneously detect various pathogenic microorganisms carried by insects. Its essence is the combination of PCR product single chain and species-specific probe to determine the difference of the amplified sequence. PCR-RLB technology has high sensitivity and specificity. It can distinguish various strains of mixed infection, and even identify species. So it was widely used in the detection of various diseases, such as Kaufhold et al. (1994) for the first time to use PCR-RLB in serotype identification of streptococcus [19]; O'Sullivan et al. (2011) used PCR-RLB technology to analyze the drug resistant strains of Staphylococcus aureus [20]; Nijhof et al. (2005) applied this method to analyze four species of Taylor in Africa [21].
The aim of this study was to develop an optimized PCR-RLB hybridization assay which could simultaneously detect 7 kinds of bacteria including Staphylococcus aureus, Shigella flexneri, Aeromonas caviae, Vibrio vulnificus, Salmonella enterica subsp. entericaserovar typhimurium, Proteus vulgaris and Yersinia enterocolitica subsp. enterocolitica efficiently and quickly. And this method was used to gather information on the bacteria carried by houseflies randomly obtained from four different environment including residential area, slaughterhouse, garbage and hospital in Lanzhou, China. The effects of different urban environments on the fly-borne bacteria were preliminarily discussed.
Standard strains of 7 bacterial species used to develop the assay were purchased from Shanghai Bioplus Biotech Co., Ltd (Shanghai, China), and their sources are shown in Table 1. The standard strains were identified by VITEK 2 Compact automatic bacterial identification and analysis system from the microbiology laboratory of the Quarantine Service (Gansu Provincial Center for Disease Control and Prevention (GSCDC), Lanzhou, Gansu province, China).
Species | Strain ID number |
---|---|
Staphylococcus aureus | ATCC 25923 |
Shigella flexneri | ATCC 12022 |
Aeromonas caviae | ATCC 15468 |
Vibrio vulnificus | ATCC 17802 |
Salmonella enterica subsp. enteric serovar typhimurium | ATCC 13311 |
Proteus vulgaris | ATCC 29905 |
Yersinia enterocolitica subsp. Enterocolitica | ATCC 17802 |
ATCC, American Type Culture Collection |
A total of 1060 houseflies were randomly collected from four different environments in Lanzhou of China, including residential area (n = 380), slaughterhouse (n = 330), garbage transfer station (n = 200), hospital (n = 150) in June and July 2016. Ten samples per group were packed into autoclaved triangular flasks, 10 ml physiological saline was added, and washed by shaking for 10 min for subsequent DNA extraction.
DNA was extracted from the overnight cultures of the bacteria using DNA extraction kit for Gram-negative bacteria (ABT) according to the manufacturer’s instructions. The extracted DNA was stored at -20 ºC until the subsequent analysis. Briefly, 1 ml of the overnight bacterial culture was centrifuged for 5 min at 10000 rpm, the supernatant was discarded. 1 ml physiological saline was added in the precipitate, and the above mixture was shocked to disperse bacteria and then centrifuged for 5 min at 10000 rpm, the supernatant was discarded. 200 µl of sterilized ddH2O was then added, mixed thoroughly and the supernatant was discarded after centrifuging for 3 min at 13000 rpm. After adding 50 µl nucleic acid extract into the bacteria precipitate, mixed thoroughly and centrifuged instantaneously, the hanging wall liquid was flung to the bottom of the EP tube. The EP tube containing the bacteria solution was heated in water bath at 100 ºC for 10 min, and then centrifuged for 10 min at 13000 rpm, the supernatant was used as the DNA template in subsequent amplification experiments.
The 16S RNA was found out to be highly conservative, according to the literature [22] and the GenBank database. The sequence alignment of the ribosome 16S RNA of 7 bacterial species (S. aureus, S. flexneri, A. caviae, V. vulnificus, S. enterica, P. vulgaris, Y. enterocolitica) was carried out. Universal primer (RLB-F, RLB-R) for PCR amplification of genomic DNA samples used in PCR-RLB hybridization assay, species-specific probe and universal probe (Catch-all) were designed using DNAStar and Primer premier software. To test for theoretical specificity, all the primers and probes used were aligned with the sequence databases of the National Center for Biotechnology Information (NCBI) using the Basic Local Alignment Search Tool (BLASTn). Universal primers were labelled at the 5’-end with biotin to allow PCR products to be detected by hybridisation with a streptavidin–peroxidase substrate in the RLB assay. All probes were labelled at the 5’-end with an amine group to facilitate covalent linkage to nylon membranes and to allow membranes to be stripped and reused repeatedly. The primers and probes were synthetized by Sangon Biotech Company, China (Table 2).
Primer-Probe | Primer-probe sequence (5’-3’) | base number | Total provision (O.D) | Optimal concentrations (µM) | Purification method |
---|---|---|---|---|---|
RLB-F | AGYGGCGGACGGGTGAGTAA | 20 | 5 | 50 | ULTRAPAGE |
RLB-R | Biotin-CCATTGTAGCACGTGTGTAGCCC | 23 | 5 | 50 | ULTRAPAGE |
Catch-all | (NH2)-CAGGATTAGATACCCTGGTAGTCC | 24 | 10 | 50 | HPLC |
S. aureus-1 | (NH2)-TCAAAAGTGAAAGACGGTCTTGC | 23 | 10 | ---- | HPLC |
S. aureus-2 | (NH2)-CAACATATGTGTAAGTAACTGTGCAC | 23 | 10 | 50 | HPLC |
S.flexneri-1 | (NH2)-GGAGTAAAGTTAATACCTTTGC | 22 | 10 | ---- | HPLC |
S.flexneri-2 | (NH2)-CTGATACTGGCAAGCTTGAGTCTCGT | 26 | 10 | 50 | HPLC |
A.caviae-1 | (NH2)-CGAGGAGGAAAGGTCAGTAGC | 21 | 10 | ---- | HPLC |
A.caviae-2 | (NH2)-GGAATCAGAACACAGGTGCT | 20 | 10 | 100 | HPLC |
V.vulnificus | (NH2)- AGAGAATTCTAGCGGAGACGCG | 22 | 10 | 100 | HPLC |
S.enterica | (NH2)-AGAAGAATCCAGAGATGGATTG | 22 | 10 | 100 | HPLC |
P. vulgaris-1 | (NH2)-GGTGATAAAGTTAATACCTTTGTCAA | 26 | 10 | 100 | HPLC |
P. vulgaris-2 | (NH2)-CGAATCCTTTAGAGATAGAGGA | 22 | 10 | ---- | HPLC |
Y.enterocolitica-1 | (NH2)-GGCCAATAACTTAATAGGTTG | 21 | 10 | ---- | HPLC |
Y.enterocolitica-2 | (NH2)-AGAACTTAGCAGAGATGCTTCG | 22 | 10 | 100 | HPLC |
Genomic DNA (100 ng) was added to a reaction mixture (final volume of 25 µl) containing 40M of both primer RLB-F and RLB-R. PCR amplification was performed in an automatic DNA thermocycler (Eppendorf). The reaction was incubated at 94 ºC for 5 min to denature genomic DNA and the thermal cycle reaction programme was: 30 s at 94 ºC, 30 s at 63 ºC and 45 s at 72 ºC for 35 cycles with a final extension step of 72 ºC for 10 min. Samples were held at 12 ºC until analysis.
The RLB protocol was performed as described previously [23]. Briefly, a Biodyne C blotting membrane (BNBCH5R, Pall BioSupport) was activated at room temperature by incubating in 16% EDAC (E7750, Sigma) for 10 min, then washed in distilled water, and placed in a MN45 miniblotter (FZB, Germany). Species-specific oligonucleotide probes were diluted to different concentrations (25, 50, 100, 200, 500, 800, 1000 µM) in 500 mM NaHCO3 (pH 8.4), added to the miniblotter slots, and incubated for 2 min. Then, the membrane was incubated in 100 mM NaOH for 10 min and rinsed with demineralized water at 60 °C for 5 min in 2 × SSPE/0.1% SDS. The membrane was then placed perpendicular to the probe orientation in the miniblotter. Twenty microliters of each PCR product was diluted in 2 × SSPE with SDS 10% w/v to a final volume of 150 µl, heated to 99 °C for 10 min, and then cooled immediately on ice. The denatured PCR products were then added to the slots in the miniblotter and incubated for 60 min at 60 °C, and the membrane was washed twice at 60 °C for 10 min in 2 × SSPE with SDS 0.5%. Additionally, the membrane was treated at 42 °C for 60 min with peroxidase-labeled streptavidin diluted 1:4000 in 2 × SSPE/0.5% SDS and washed twice at 42 °C for 10 min in 2 × SSPE/0.5% SDS and twice at room temperature for 5 min in 2 × SSPE. Finally, chemiluminescence detection was performed according to standard procedures (Amersham).
For specificity studies, DNA was extracted from standard strains (Table 1) using a DNA extraction kit for Gram-negative bacteria (ABT) according to the manufacturer’s instructions, and was tested against all probe sets.
To assess RLB sensitivity, the genomic DNA content of the standard strains was determined by nucleic acid concentration meter (NanoDrop ND-2000). Serial ten-fold dilutions of genomic DNA (starting at 100 ng/µl) were prepared into 10− 1-10− 12 in distilled water and then used as template for the RLB sensitivity analysis.
A pair of primers (RLB-F, RLB-R) 20–23 bp in length was designed for amplification of all standard strains, with amplicon sizes in the range 104–1270 bp. The result of PCR amplification was shown in Fig. 1. The size of PCR amplification products is about 1100 bp, consisted with the amplicon sizes of the designed primers, which reveals the designed primers can successfully amplified the target sequence fragments.
Twelve different oligonucleotide probes directed against 7 bacterial species were designed. In addition, a universal probe targeting the 16S rRNA gene was used as a control. A. caviae-1 probe, P. vulgaris-2 probe did not show any cross-reaction with 7 standard strains. In addition, S. aureus-1, S. flexneri-1, Y. enterocolitica-1 probe simultaneously identified two bacterial species. Therefore these five oligonucleotide probes cannot be used in PCR-RLB experiments. The finally selected oligonucleotide probes were S. aureus-2, S. flexneri-2, A. caviae-2, V. vulnificus, S. enterica, P. vulgaris-1, Y. enterocolitica-2 probe (Fig. 2).
Initial evaluation experiments revealed that the optimal primer concentration of RLB-F and RLB-R was 50 µM; the optimal probe concentration was 50 µM for Catch-all, S.aureus-2 and S.flexneri-2 probe, and 100 µM for other selected probes (Table 2).
All selected probes bound only to their respective target sequence, resulting in the recognition of individual bacterial species. The nucleotide probes did not show any cross-reaction with water used as a blank control. The catch-all probe specifically detected any standard strains present. Each standard strain was identified by two oligonucleotide probes: the catch-all probe and species-specific probes for either 7 bacterial species (Fig. 3).
The RLB assay is capable of detecting about 10− 8 ng/µL (S. aureus), 10− 8 ng/µL (S. flexneri), 10− 6 ng/µL (A.caviae), 10− 6 ng/µL (V. vulnificus), 10− 11 ng/µL (S. enterica), 10− 6 ng/µL (P. vulgaris), and 10− 11 ng/µL (Y. enterocolitica) (Fig. 4). To test the capacity of the developed PCR-RLB assay to detect 7 bacterial species, subjected to PCR and subsequently evaluated. The sensitivity of traditional PCR was shown in Fig. 5: 10− 4 ng/µL (S. aureus), 10− 2 ng/µL (S. flexneri), 10− 4 ng/µL (A.caviae), 10− 4 ng/µL (V. vulnificus), 10− 7 ng/µL (S. enterica), 10− 4 ng/µL (P. vulgaris), 10− 3 ng/µL (Y. enterocolitica). The results showed that the sensitivity of PCR-RLB was significantly higher (about 100 times) than that of PCR.
In summary, 1060 housefly samples (divided into 106 groups) from four different environments in Lanzhou of China were detected for 7 fly-borne bacterial pathogenic microorganisms by using RLB. Compared with traditional PCR, the PCR-RLB method can accurately detect different bacterial species corresponding to species-specific oligonucleotide probes, and the unknown bacterial species can be detected by universal probes. The results shown in Fig. 6 can not only clearly display the bacterial carrying status of samples, but also analyze the carrying and carrier rate of bacteria corresponding to different probes in different environments. The detail of the analysis results was shown in Fig. 7 and Table 3.
residential area | Slaughterhouse | garbage transfer station | hospital | total | carrier rate (%) | |
---|---|---|---|---|---|---|
S. aureus | 0 | 0 | 0 | 2 | 2 | 1.23 |
S. flexneri | 19 | 18 | 6 | 9 | 52 | 32.1 |
A. caviae | 0 | 0 | 0 | 0 | 0 | 0 |
V.vulnificus | 0 | 0 | 0 | 3 | 3 | 1.85 |
S. enterica | 22 | 17 | 13 | 4 | 56 | 34.57 |
P. vulgaris | 0 | 0 | 0 | 1 | 1 | 0.62 |
Y. enterocolitica | 10 | 7 | 8 | 8 | 33 | 20.37 |
Others | 5 | 6 | 3 | 1 | 15 | 9.26 |
Total | 56 | 48 | 30 | 28 | 162 |
The proportions of 7 pathogenic species carried by all samples from four different environments (106 groups of samples) were 1.23% (S. aureus), 32.1% (S. flexneri), 0% (A. caviae), 1.85% (V. vulnificus), 34.57% (S. enterica), 0.62% (P. vulgaris), 20.37% (Y. enterocolitica), respectively. In general, A. caviae is not carried by all samples. S. flexneri, S. enteric, Y. enterocolitica are the most prevalent pathogenic species carried by houseflies. It is worth noting that houseflies near hospital carried almost all these pathogenic species except A. caviae. The carrier rates of Y. enterocolitica carried by houseflies in residential areas and garbage transfer station are the highest. And S. flexneri carried by houseflies is the most popular in slaughterhouse and hospital.
In all kinds of bacterial detection experiments, the first thing is to clarify the source of bacterial strain, and confirm that bacterial strain did not mutate, so all the standard strains used in this study have been identified. Sequence alignment of 16S RNA gene sequences of 7 standard bacterial strains with clear background was carried out, universal primers and species-specific oligonucleotide probes were successfully designed. The target sequences of all bacterial strains were successfully amplified by using universal primers for PCR amplification. And species-specific probes (S.aureus-2, S.flexneri-2, A.caviae-2, V. vulnificus, S. enteric, P. vulgaris-1, Y. enterocolitica-2) aimed at the target gene sequences were successfully screened out. The common primers were used for PCR amplification. The target sequences of all strains were successfully amplified, and the target sequences were successfully screened out. A simultaneous detection method of 7 bacteria species by PCR-RLB was successfully established. The sensitivity of the PCR amplification products with different concentration prepared by serial ten-fold dilutions was tested. The results showed that the sensitivity of PCR-RLB was significantly higher (about 100 times) than that of PCR, which is consistent with literature reports [23–29].
In summary, a high specificity and sensitivity method for the simultaneous detection of 7 bacteria strains by PCR-RLB was successfully established in this study. This method was used to detect 7 bacteria species carried by housefly in four different environments in Lanzhou. PCR-RLB method could directly and accurately detect fly-borne bacteria species corresponding of 7 species-specific probes. At the same time, the membrane binding oligonucleotide species-specific probes prepared in RLB detection technology can be reused for detection of bacteria after washing with 0.5 M EDTA, which greatly improves the detection efficiency. In 106 groups of samples, the numbers of samples carrying seven different bacterial strains were 2 (S. aureus), 52 (S. flexneri), 0 (A. caviae), 3% (V. vulnificus), 56 (S. enterica), 1 (P. vulgaris) and 33 (Y. enterocolitica), respectively. Their proportions of 7 bacterial strains carried by houseflies were 1.23% (S. aureus), 32.1% (S. flexneri), 0% (A. caviae), 1.85% (V. vulnificus), 34.57% (S. enterica), 0.62% (P. vulgaris) and 20.37% (Y. enterocolitica), respectively. It was found that the worse the hygienic condition, the higher the bacteria carrying rate of houseflies was. S. enterica, S. flexneri and Y. enterocolitica accounted for the overwhelming majority of the seven pathogenic strains carried by houseflies from four different environments in Lanzhou. This indicated that houseflies played an important role in the transmission of intestinal diseases, which was mainly related to the breeding and reproduction of houseflies in feces, carrion and food. S. aureus was carried by houseflies in the hospital area indicates that hospitals should do well in killing and controlling flies and further strengthen the prevention and control of fly-borne bacterial diseases. The above results indicate that we should improve the urban environment and block the source of vector transmission, so as to effectively control the spread of insect-borne diseases.
The aim of this study was to develop a sensitive, reliable and rapid method for the simultaneous detection of multiple fly-borne bacterial pathogenic microorganisms, in order to effectively prevent and control fly-borne bacterial diseases. A PCR-based reverse line blot (PCR-RLB) hybridisation assay was developed. All species-specific probes designed for the RLB hybridised with amplified DNA only from the corresponding species. The sensitivity of the PCR amplification products with different concentration prepared by serial ten-fold dilutions was tested, and the results showed that the sensitivity of PCR-RLB was significantly higher (about 100 times) than that of PCR. This method was then used to gather information on the bacteria carried by houseflies randomly obtained from four different environments in Lanzhou, China. The effects of different urban environments on the fly-borne bacteria were preliminarily discussed. The RLB assay appeared to have potential clinical application in the simultaneous detection of fly-borne bacterial species.
PCR:polymerase chain reaction; PCR-RLB:PCR-based reverse line blot hybridization; EDTA:ethylene diamine tetraacetic acid.
Acknowledgments
Pro. Jianxiong Luo, Dr. Qingli Niu, and Dr. Qiaoyun Ren are thanked for their support of and assistance with the experiment and the collection of specimens.
Authors’ contributions
Yonghua Ma, Huitian Gou and Xiaolin Sun conceived and designed the experiments. Zexiang Wang, Mei Li and Yuxiao Teng were instrumental in the acquisition of data. Yonghua Ma, Huitian Gou and Xiaolin Sun analysed the data and wrote the manuscript. All authors read and approved the final manuscript.
Funding
The project was supported by the fund of Gansu Agricultural University (GAU-KYQD-2017RCZX-11, GAU-XKJS-2018-073), Gansu Province natural sciences fund (18JR3RA167), Key research and development projects in gansu province (18YF1FA080), Lanzhou science and technology plan project (2017-4-103), Biotechnology Project of Gansu Agriculture and Animal Husbandry Department (GNSW-2014-9), National Natural Science Regional Foundation Project (CN) (31460659) and Open Fund of State Key Laboratory of Pathogenic Biology of Livestock Epidemic Diseases (SKLVEB2014KFKT002). No information has been provided by the authors concerning the existence or absence of conflicting or dual interests.
Availability of data and materials
All data generated or analyzed during this study are included in this published article.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.