Prevalence and molecular characterization of methicillin-resistant Staphylococcus aureus with mupirocin, fusidic acid and/or retapamulin resistance

doi:10.21203/rs.2.21815/v1

Data on the prevalence of resistance to mupirocin (MUP), fusidic acid (FA) and retapamulin (RET) in methicillin-resistant Staphylococcus aureus (MRSA) from China are still limited. In this study we examined these three antibiotics resistance pheno and geno-typically in 1206 MRSA clinical isolates. Phenotypic MUP, FA and RET resistance was determined by MICs, and genotypically by PCR and DNA sequencing examining genes mupA / B , fusB - D , cfr and vgaA / Av , and mutations in ileS , fusA / E , rplC , and 23S RNA V domain. The genetic characteristics of resistance isolates were conducted by PFGE and MLST. Overall MRSA MUP, FA and RET resistance was low (5.1%, 1.0% and 0.3%, respectively). The mupA was the mechanism of high-level MUP resistance. All low-level MUP resistance isolates possessed an equivocal mutation N213D in IleS, and 2 of them additionally had the reported V588F mutation impacting the Rossman fold. FusA mutations, such as L461K, H457Q, H457Y and V90I, were the primary FA resistance mechanisms among high-level resistance isolates, most of which contained fusC ; however, all low-level resistance strains carried fusB . No resistance mechanisms detected were found among RET resistance isolates. Genetic analysis demonstrated clone spread for MUP resistance isolates. In conclusion, MUP, FA and RET exhibited highly activity against MRSA isolates. Acquired genes and chromosome-borne genes mutations were responsible for MUP and FA resistance, and further investigation is needed to uncover the RET resistance mechanisms. Moreover, the surveillance to MUP in MRSA should be strengthened to prevent resistance increase due to the expansion of clones.

Applied & Industrial Microbiology

General Microbiology

Methicillin-resistant Staphylococcus aureus

Mupirocin

Fusidic acid

Retapamulin

Resistance mechanisms

Genetic characteristics

Methicillin-resistant Staphylococcus aureus (MRSA) is a major pathogen responsible for various hospital- and community-associated infectious on a worldwide scale [1]. Because of strong resistance, MRSA brings great challenges to clinical anti-infective therapy, leading to high risk of mortality and expensive medical expenses [1].

Skin and soft tissue infections (SSTIs) are one of the common diseases caused by S. aureus, including MRSA [2], which are able to be treated with topical antibiotics mupirocin (MUP) and fusidic acid (FA) [3]. However, long-term unreasonable use of these drugs leads to the emergence of resistance, which has become a significant public health problem [3]. Therefore, novel topical antimicrobial agent retapamulin (RET) is developed for the treatment of S. aureus SSTIs [3].

MUP resistance in staphylococcus is divided into two phenotypes: high-level (MuH, MIC ≥ 512 µg/ml) and low-level (MuL, MIC = 8ཞ256 µg/ml) [3, 4]. The MuH is mediated by gene mupA or mupB, and the MuL is related to point mutations in the isoleucyl-tRNA synthetase gene (ileS) [3, 5]. For FA resistance (MIC ≥ 2 µg/ml) [3, 6], the molecular mechanisms are associated with mutations in fusA or fusE located in chromosome (conferring high-level resistance, FAH) and/or acquired fusB family genes, including fusB, fusC and fusD (mediating low-level resistance, FAL) [3, 7]. RET, belonging to pleuromutilin antibiotics, has been licensed in USA and Europe for the topical treatment of SSTIs caused by methicillin-sensitivity S. aureus and Streptococcus pyogenes [8]. RET resistance in S. aureus is often mediated by the point mutations of ribosomal protein L3 (encoded by rplC) or the 23S rRNA V domain, or efflux pumps VgaA/VgaAv (encoded by the vgaA or vgaAv gene), or methylation of the 23S rRNA subunit [methylated by methyltransferase encoded by chloramphenicol-florfenicol resistance (cfr) gene] [3].

Several previous studies reported the resistance of MUP and FA in Eastern China [9, 10–12]. However, in view that Eastern China is a region with a vast territory, the antibiotic resistance spectrum and the resistance mechanisms may change in diverse hospitals. Therefore, those data in the aforementioned documents on the resistance of both drugs in clinical isolates of S. aureus are limited. In addition, to the best of our knowledge, there is no information on RET resistance in China.

In this study, we determined the prevalence of MUP, FA and RET resistance among MRSA isolates from Shanghai and Zhejiang province in Eastern China, and analyzed the resistance mechanisms in the resistant isolates. Furthermore, to understand the genetic characterization of resistant isolates, PFGE and MLST genotyping was also carried out.

Bacterial isolates

A total of 1206 non-duplicate MRSA isolates from various clinical specimens were separated from 8 hospitals collection in Shanghai and Zhejiang province, Eastern China [Shanghai General Hospital (1037 isolates from July 2010 to June 2015), Ruijin Hospital (22 isolates during January 2011 to December 2011), Shanghai Sixth People′s Hospital (36 isolates between Decermber 2010 and Decermber 2012), Shanghai People′s Hospital of Putuo District (45 isolates from January 2013 to May 2014), Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine (45 isolates from February 2014 to September 2014), Shanghai Armed Police Corps Hospital (9 isolates from January 2014 to June 2014 ), Zhejiang Xiaoshan Hospital (8 isolates from March 2012 to October 2012) and The Central Hospital of Lishui City, Zhejiang Province (28 isolates, July 2013 to September 2014)]. Most of these isolates were isolated from respiratory samples (80%). Intensive care units, respiratory medicine, geriatric medicine, thoracic surgery and nephrology wards were the units impacted by MRSA isolates. All isolates were identified using VITEK microbial identification system (bioMérieux, Marcy l′ Etoile, France). The resistance to methicillin was detected with a 30 µg cefoxitin disk (Oxoid, Basingstoke, UK) [4]. MuH (MIC ≥ 512 µg/mL), MuL (MIC = 8 to 256 µg/mL), FAH (MIC ≥ 8 µg/mL), FAL (MIC = 2 to 4 µg/mL) and RET resistance (MIC ≥ 1 µg/mL was defined as resistance in this study) were screened from all the isolates collected by broth microdilution method [4, 6, 12, 13]. For three-antibiotic resistant isolates, the methicillin resistance was further confirmed by amplification of mecA and mecC genes [14]. MUP, FA and RET were purchased from Shanghai Boyle Chemical Co., Ltd., China. S. aureus ATCC 25923 and ATCC 29213 were used as quality control strains for antibiotic susceptibility testing.

DNA Extraction

The cultures of MRSA with MUP, FA and/or RET resistance were incubated with lysostaphin (1 mg/mL) (Sangon, Shanghai, China) at 37 °C for 0.5 h. Then, the DNA was extracted according to the instructions of the bacterial genomic DNA kit (Tiangen, Beijing, China), and utilized as a template for PCR assays.

Detection of mupirocin, fusidic acid and retapamulin resistance genes

PCR was used to detect determinants mediating MUP [mupA, mupB and ileS (amplifying three fragments of Smr, Mrm and Lmr, which possibly possess the mutations mediating mupirocin resistance)], FA (fusA, fusB, fusC, fusD and fusE) and RET (rplC, cfr, vgaA/Av and 23S RNA V) resistance [5, 7, 12, 15–19]. The primers for the amplification of genes were presented in Table 1. DNA sequencing of one randomly selected PCR product for mupA, mupB, fusB, fusC, fusD, cfr and vgaA/Av was used for the identification of target fragments. All the PCR products for ileS-Smr, ileS-Mrm, ileS-Lmr, fusA, fusE, rplC and 23S RNA V were sequenced to determine the possible mutations.

Table 1

Primers for detecting mupirocin, fusidic acid and retapamulin resistance genes in this study.
Gene	Primer name	Primer sequence (5’-3’)	Size	Reference
mupA	mupA-F	TATATTATGCGATGGAAGGTTGG	457 bp	18
mupA	mupA-R	AATAAAATCAGCTGGAAAGTGTTG	457 bp
mupB	mupB-F	CTAGAAGTCGATTTTGGAGTAG	674 bp	9
mupB	mupB-R	AGTGTCTAAAATGATAAGACGATC	674 bp
ileS (including the following 3 fragments)
Smr	Smr-F	ATAAAGGTAAAAAGCCAGTTTATTGGT	200 bp	21
Smr	Smr-R	TAATCGCAACATTTGATGGAATTGTC	200 bp
Mrm	Mrm-F	TCCCAGCAGATATGTATTTAGAAGGT	450 bp
Mrm	Mrm-R	AACCACTTGGTCAGGTACAATCACA	450 bp
Lmr	Lmr-F	GTAAATCTTTAGGTAATGTGATTGTAC	690 bp
Lmr	Lmr-R	TCTTCTTTAACATGTGGTGTATGAGA	690 bp
fusA	fusA-F	TTTACCCTGAGTGTGTTCT	2250 bp	11
fusA	fusA-R	TACATTTAAGCTCACCTTGT	2250 bp
fusB	fusB-F	TCATATAGATGACGATATTG	496 bp	22
fusB	fusB-R	ACAATGAATGCTATCTCGAC	496 bp
fusC	fusC-F	GATATTGATATCTCGGACTT	128 bp
fusC	fusC-R	AGTTGACTTGATGAAGGTAT	128 bp
fusD	fusD-F	TGCTTATAATTCGGTCAACG	525 bp
fusD	fusD-R	TGGTTACATAATGTGCTATC	525 bp
fusE	fusE-F	CCTAGTGACGTAACAGTAAC	505 bp
fusE	fusE-R	CGGCGWACRTATTCACCTTG	505 bp
rplC	rplC-F	AACCTGATTTAGTTCCGTCTA	822 bp	12
rplC	rplC-R	GTTGACGCTTTAATGGGCTTA	822 bp
cfr	cfr-F	GAGATAACAGATCAAGTTTTA	1050 bp	23
cfr	cfr-R	CGAGTATATTCATTACCTCAT	1050 bp
vgaA	vgaA-F	TCACATGATCGCGCTTTTTTAGAT	770	44
	vgaA-R	TCGCTCTCCACCACTTAAGACACT
vgaAv	vgaAv-F	CTCTTTGTACGAGTATATGG	770 bp	24
vgaAv	vgaAv-R	GTTTCTTAGTAGCTCGTTGAGC	770 bp
23S RNA V	23S RNA-F	TGGGCACTGTCTCAACGA	634 bp	25
23S RNA V	23S RNA-R	GGATAGGGACCGAACTGTCTC	634 bp
MLST typing				27
arcC	arcC-F	TTGATTCACCAGCGCGTATTGTC	456 bp
arcC	arcC-R	AGGTATCTGCTTCAATCAGCG	456 bp
aroE	aroE-F	ATCGGAAATCCTATTTCACATTC	456 bp
aroE	aroE-R	GGTGTTGTATTAATAACGATATC	456 bp
glpF	glpF-F	CTAGGAACTGCAATCTTAATCC	465 bp
glpF	glpF-R	TGGTAAAATCGCATGTCCAATTC	465 bp
gmk	gmk-F	ATCGTTTTATCGGGACCATC	429 bp
gmk	gmk-R	TCATTAACTACAACGTAATCGTA	429 bp
pta	pta-F	GTTAAAATCGTATTACCTGAAGG	474 bp
pta	pta-R	GACCCTTTTGTTGAAAAGCTTAA	474 bp
tpi	tpi-F	TCGTTCATTCTGAACGTCGTGAA	402 bp
tpi	tpi-R	TTTGCACCTTCTAACAATTGTAC	402 bp
yqiL	yqiL-F	CAGCATACAGGACACCTATTGGC	516 bp
yqiL	yqiL-R	CGTTGAGGAATCGATACTGGAAC	516 bp

PFGE Typing

Pulsed field gel electrophoresis (PFGE) was performed for MUP, FA and/or RET resistant strains as described by previous investigation [20]. BioNumerics software 7.0 was used for the analysis of DNA fingerprint profiles. An 80% cutoff value for similarity was utilized.

MLST Typing

Multilocus sequence typing (MLST) was conducted by sequencing of internal fragments of 7 housekeeping genes arcC, aroE, glpF, gmk, pta, tpi and yqiL on MUP, FA and/or RET resistant MRSA using the primers (listed in Table 1) as depicted previously [21]. Sequence types (STs) were determined on the basis of data from the MLST database for S. aureus (http://saureus.mlst.net/).

Prevalence of mupirocin, fusidic acid and retapamulin resistance

By screening of 1206 MRSA isolates using broth microdilution assay, we identified 49 MuH, 12 MuL, 6 FAH, 6 FAL, 2 RET resistant and 1 MuH-RET resistant isolates. The detailed MIC data of the MUP, FA and RET resistance isolates were listed in Fig. 1.

Mechanisms Of Mupirocin Resistance

Forty-nine MuH and 1 MuH-RET resistant isolates all contained the mupA gene, and no isolates were mupB positive (Table 2). The sequences of Smr, Mrm and Lmr DNA fragments were compared with the known ileS gene of S. aureus (Gene bank accession no. X74219). The findings showed that all 12 MuL isolates possessed N213D mutation in Smr fragment, and 2 MuL isolates had V588F mutation in Mrm fragment. No mutations were identified in Lmr fragment. In addition, no mupA or mupB gene was detected in MuL isolates.

Table 2

Resistance mechanisms of 76 mupirocin, fusidic acid and/or retapamulin-resistant clinical MRSA isolates.
Strain	Resistance phenotype and mechanism
	Mupirocin						Fusidic acid							Retapamulin
	Phenotype	mupA	mupB	IleS mutation			Phenotype	Fus A mutation	fusB	fusC	fusD	Fus E mutation	Phenotype	rplC mutation	23S rRNA V mutation	cfr	vagA/Av
	Phenotype	mupA	mupB	Smr	Mrm	Lmr	Phenotype	Fus A mutation	fusB	fusC	fusD	Fus E mutation	Phenotype	rplC mutation	23S rRNA V mutation	cfr	vagA/Av
PT300	MuL	―	―	N213D	V588F	NM	S						S
PT343	MuH	+	―				S						S
355	MuH	+	―				S						S
546	MuL	―	―	N213D	NM	NM	S						S
370	MuH	+	―				S						S
532	MuL	―	―	N213D	NM	NM	S						S
519	MuH	+	―				S						S
472	MuL	―	―	N213D	NM	NM	S						S
409	MuH	+	―				S						S
671	MuH	+	―				S						S
443	MuH	+	―				S						S
530	MuH	+	―				S						S
120	MuH	+	―				S						S
322	MuH	+	―				S						S
328	MuH	+	―				S						S
448	MuH	+	―				S						S
474	MuH	+	―				S						S
526	MuL	―	―	N213D	NM	NM	S						S
565	MuH	+	―				S						S
600	MuH	+	―				S						S
606	MuL	―	―	N213D	NM	NM	S						S
623	MuH	+	―				S						S
642	MuH	+	―				S						S
673	MuL	―	―	N213D	NM	NM	S						S
694	MuH	+	―				S						S
697	MuH	+	―				S						S
70	MuH	+	―				S						S
701	MuH	+	―				S						S
717	MuH	+	―				S						S
PT317	MuH	+					S						S
318	MuH	+	―				S						S
106	MuH	+	―				S						S
331	MuH	+	―				S						S
364	MuH	+	―				S						S
486	MuH	+	―				S						R	NM	NM	―	―
553	MuH	+	―				S						S
777	MuL	―	―	N213D	NM	NM	S						S
504	MuH	+	―				S						S
394	MuH	+	―				S						S
805	MuH	+	―				S						S
453	MuH	+	―				S						S
727	MuH	+	―				S						S
764	MuH	+	―				S						S
433	MuH	+	―				S						S
541	MuH	+	―				S						S
631	MuH	+	―				S						S
696	S						FAL	NM	+	―	―	NM	S
635	MuL	―	―	N213D	NM	NM	S						S
320	MuH	+	―				S						S
348	MuH	+	―				S						S
349	MuH	+	―				S						S
110	S						FAH	L461K	―	+	―	NM	S
829	S						FAH	H457Q	―	+	―	NM	S
PT301	S						FAH	L461K	―	+	―	NM	S
PT308	S						FAH	L461K	―	+	―	NM	S
399	MuH	+	―				S						S
422	MuH	+	―				S						S
419	MuH	+	―				S						S
390	MuH	+	―				S						S
125	MuH	+	―				S						S
755	S						FAL	NM	+	―	―	NM	S
783	S						FAL	NM	+	―	―	NM	S
361	S						FAL	NM	+	―	―	NM	S
611SG	S						FAL	NM	+	―	―	NM	S
58	S						S						I	NM	NM	―	―
765	S						FAL	NM	+	+	―	NM	S
323	MuH	+	―				S						S
386	MuH	+	―				S						S
575	MuL	―	―	N213D	NM	NM	S						S
LY26	S						FAH	E8K, V90I, L461K	―	―	―	NM	S
LY32	S						FAH	H457Y	―	―	―	NM	S
WU9	MuL	―	―	N213D	V588F	NM	S						S
308	MuL	―	―	N213D	NM	NM	S						S
513	MuH	+	―				S						S
LS964	S						S						R	NM	NM	―	―
314	MuH	+	―				S						S
MRSA, methicillin-resistant S. aureus; +, Positive; ―, Negetive; IleS, isoleucyl-tRNA synthetase; MuH, high-level mupirocin resistance; MuL, low-level mupirocin resistance; FAH, high-level fusidic acid resistance; FAL, low-level fusidic acid resistance; NM, No mutation; R, resistance; I, intermediate; S, susceptibility.

Mechanisms Of Fusidic Acid Resistance

To uncover the mechanisms of FA resistance among 6 FAH isolates, the full-length of fusA and fusE genes was sequenced, and compared with that of S. aureus ATCC 25923. We identified that 2 isolates contained H457Q missense mutation, and 4 had mutation L461K in FusA. Among 4 strains with L461K mutation, 1 simultaneously possessed E8K and V90I mutations (Table 2). All FA resistance isolates were detected for fusB, fusC and fusD. For 6 FAH isolates, 4 carried fusC gene. Among 6 FAL isolates, all were fusB positive, and only one carried fusC gene (Table 2). No mutations were found in fusE, and no isolates were fusD positive.

Mechanism Of Retapamulin Resistance

For 3 isolates with resistance to RET, no resistance mechanisms detected in this study were observed.

PFGE

All isolates (76 isolates) with MUP, FA and/or RET resistance were divided into 16 patterns (type A to P) (Fig. 1). Among 49 MuH strains, 40 belonged to type B, 4 were type E, 5 belonged to type A, F, J, K and N, respectively. One MuH-RET resistant isolate was also type B. Among 12 MuL isolates, 9 were type B, and 3 belonged to type A, M and N, respectively. Type C was the most frequent type in FAH strains (3/6; 50%). Type G was the most common pattern in FAL strains (4/6; 66.7%). Two RET resistant MRSA belonged to type O and H, respectively.

MLST

Fifteen different STs were identified among 76 isolates studied (Fig. 1). ST764 (24/76, 31.6%) was the most frequent pattern, followed by ST630 (11/76, 14.5%), ST239 (9/76, 11.8%) and ST5 (7/76, 9.2%) and 11 additional STs, namely ST4631 and ST1821 (4/76 each, 5.3%), ST9, ST3262 and ST4184 (3/76 each, 3.9%), ST1 and ST20 (2/76 each, 2.6%), ST965, ST398, ST4359 and ST97 (1/76 each, 1.3%).

Mupirocin is effective for the prevention and treatment of MRSA infections. However, the resistance (including MuL) is able to lead to MRSA treatment and eradication failure [22, 23]. The prevalence rate of MUP resistance is various in MRSA clinical isolates worldwide, from 0.5–10.1% for MuH and 2.4–8.6% for MuL in America, from 0–75% for MuH and 0%% to 46.7% for MuL in Asia, and from 0.8–98% for MuH and 0–31.2% for MuL in Europe [22]. In our present study, the isolation rates of MuH and MuL were low, namely 4.1% (50/1206) and 1.0% (12/1206), respectively. Recent large studies displayed that the prevalence of MuH is mediated by plasmid-borne mupA gene [22], this is the same as our results. Although mupB, also a plasmid-borne gene, is correlated with MuH [5], this mechanism is rarely examined in staphylococci, including the isolates investigated in the present study. The point mutations in the ileS gene, resulting in amino changes in MUP-binding site (also named Rossman fold), are the main mechanisms determining MuL [22]. V588F and V631F are well identified the most frequent mutations in IleS responsible for MuL [22]. In this study, only two MuL isolates (PT300 and wu9) contained the V588F mutation, and no MuL isolates harbored the V631F mutation. Notably, all MuL isolates harbored N213D mutation, which located in a hotspot amino acid sequence between 200 to 350 described by Lee et al [24]. The N213D mutation had been previously reported, and are considered to have no impact on the sensitivity of MUP [25]. Although the mupA gene located on chromosome is also associated with MuL [3], we did not detect the gene in our MuL isolates. In addition, no other mutations in IleS were found. Lee et al. [24] reported that a mutation of S634F could confer phenotype of susceptibility or MuL in diverse isolates. In view of this phenomenon, the contribution of N213D mutation to MuL should be evaluated further.

Fusidic acid is a steroidal antimicrobial agent, and suppresses the production of bacterial proteins by stopping the dissociation of elongation factor G (EF-G) from ribosome [6, 26]. In clinic, the main applications of topical FA are the treatment of SSTIs and decolonization of S. aureus including MRSA, which is similar to those for MUP [3]. The prevalence of FA resistance reported by recent large studies varies in MRSA isolates from USA (0%-0.3%), Australian (4.1%-5.1%), Denmark (17.8%), Greece (57.0%) and other European countries (9.9%) [3]. In China, the resistance levels in MRSA are also different in different areas, for example 3.0%-5.3% in MRSA from Beijing, Shanghai, Shenyang and Shenzhen cities [10, 27], and 27.1% in MRSA from Wenzhou city [9]. Compared with the aforementioned data from China, our results showed a very low resistance rate (1.0%, 12/1026).

In S. aureus, the mutations in fusA (encoding EF-G) or fusE (coding for ribosome protein L6, RplF) lead to a decreased affinity of FA for the EF-G ribosome complex [3, 28]. There are over thirty point mutations in FusA sequence to be described, however, only a few were experimentally verified playing a role in FA resistance [3, 29, 30]. The mutations V90I, H457Y, H457Q and L461K observed in this study have been previously identified causing FAH in S. aureus [29, 31], and the L461K is the most prevalent mechanism among clinical FAL S. aureus strains [3]. In our results, the L461K also existed in most (80%, 4/6) FAL isolates. One substitution with E8K located in domain I (amino acids 1 to 280) of EF-G was identified for the first time, and occurred with the mutations of V90I and L461K in a FAH isolate. Whether the novel mutation is associated with FA resistance is not clear and needs further clarification.

Protection of EF-G by FusB family molecules is another mechanism conferring the resistance (low-level) of FA [3]. FusB family proteins (including FusB, FusC and FusD) are able to restore the translation of protein by binding to EF-G when FA exists [3]. Previous studies showed that fusB was the most prevalent in Netherlands and mainland China [9, 10, 32], and fusC main existed in isolates from Taiwan, Australia, USA and European collections [16, 33, 34]. In our isolates with FA resistance, the fusB existed in all FAL isolates (6/6), and the fusC was most prevalent in FAH isolates (66.7%, 4/6). The fusD gene was identified in Staphylococcus saprophyticus, and relates to the ‘‘intrinsic resistance of FA’’ among this species [26]. To date, this determinant is rarely detected in S. aureus strains.

Retapamulin, a semisynthetic drug, represses the synthesis of bacterial proteins by interacting with domain V of 50S ribosomal subunit [3]. This drug has a potency to act as an alternative to MUP to eradicate the S. aureus colonization, except used for the treatment of SSTIs of S. aureus [8, 35]. For RET resistance, very little published data are available among clinical S. aureus strains worldwide. The resistance rates of 664 UK S. aureus (74% of them were MRSA), 155 USA MRSA, 403 USA MRSA and 400 USA S. aureus from several different studies were 0.15%, 2.6%, 0.25%, and 9.5%, respectively [8, 35–37]. In this study, the prevalence of RET resistance was very low (0.24%, 3/1226). In UK and USA, the RET resistance among S. aureus or MRSA with MUP resistance was < 1–2.6% [8, 37]. In the present study, only one MRSA isolate was observed to be simultaneous resistance to RET and MUP. In our 3 RET resistance isolates, no resistance mechanisms studied were examined. The genetic basis for resistance to RET in these isolates remains unclear, and other potential mechanisms may need to be further explored.

ST239 and ST5 are two predominant sequence types in China. However, in this study our strains were mainly belonged to ST764 (31.6%), which was more than the total percentage of ST239 and ST5 (16/76, 21.1%). ST764 MRSA, first reported in Japan, is a single-locus of ST5 nosocomial MRSA clone with or without the arginine catabolic mobile element (ACME, a feature of CA-MRSA) [38, 39]. In recent years, several studies have reported the S. aureus clone with ST764 in China [11, 14]. Notably, multiple MUP resistance MRSA clones with different genetic patterns, such as PFGE B-ST764, PFGE B-ST1821, PFGE B-ST239, PFGE B-ST5 and PFGE B-ST630, mainly occurred in the same hospital (Shanghai General Hospital) (Fig. 1), which indicates that the dissemination of different clones is responsible for the resistance of MUP in this hospital. However, for FA resistance isolates, the genetic background (PFGE-ST) exhibited more heterogeneity. This may be due to the situation that these isolates were from different hospitals (Fig. 1).

MRSA isolates in this study exhibited a low prevalence of resistance to MUP, FA and RET, especially to the latter two, and cross-resistance to these three antibiotics was rare. The mupA gene was the mechanism mediated MuH. The contribution of the mutation N213D in IleS found in our MuL isolates to low-level resistance of mupirocin is still confusing. FusA mutations, FusB and FusC were the frequent genetic mechanisms mediated FA resistance. Phylogenetic detection showed the transmission of a main clonal isolate (PFGE B-ST764) of MUP resistant MRSA in one hospital. Because of the concern of resistance development and clonal dissemination in healthcare settings, continuous surveillance for the resistance of these topic antibiotics in S. aureus is essential in China.

MUP:mupirocin; FA:fusidic acid; RET:retapamulin; PFGE:pulsed-field gel electrophoresis; MLST:multilocus sequence typing; MuH:high-level mupirocin resistance; MuL:low-level mupirocin resistance; FAH:high-level fusidic acid resistance; FAL:low-level fusidic acid resistance; IleS:isoleucyl-tRNA synthetase; MIC:minimum inhibitory concentration; PCR:polymerase chain reaction; MRSA:methicillin-resistant Staphylococcus aureus; PFGE, Pulsed field gel electrophoresis; MLST, Multilocus sequence typing; MIC, minimum inhibitory concentration; SGH, Shanghai General Hospital; SSH, Shanghai Sixth People’s Hospital; PT, Shanghai People’s Hospital of Putuo District; SAH, Shanghai Armed Police Corps Hospital; LSH, the Central Hospital of Lishui City, Zhejiang Province; SGHA, Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine

Acknowledgments

We would like to thank all of the researchers for their dedication and contributions to the present study. We thank Dr. Shu Jin (Shanghai People's Hospital of Putuo District) for providing the methods for the lysis of S. aureus (patent number: ZL201310124795.2), and Lizhong Han, Jing Tang and Jinwei Huang for kindly supplying the MRSA clinical isolates.

Authors’ contributions

QZL designed and conceived the investigation; WJC and CYH carried out the experiments; WJC, CYH, HY, RT, ZLC, SW and CLZ analyzed the experiment data; WJC and QZL wrote and revised this manuscript. All authors had read and agreed with the final manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (No.81772247 and No.81371872), Shanghai Jiaotong University Medical-Engineering Cross Research Youth Fund (YG2016QN31), and Medical Science and Technology Plan (Young Talents) of Zhejiang province (2019RC256).

Availability of data and materials

All data generated or analyzed during this study are included in this article.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

None declared.

Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, MIC Holland TL, Fowler VG Jr. Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol. 2019;17(4):203-18.
Bassetti M, Carnelutti A, Righi E. The role of methicillin-resistant Staphylococcus aureus in skin and soft tissue infections. Curr Opin Infect Dis. 2017;30(2):150-7.
Williamson DA, Carter GP, Howden BP. Current and emerging topical antibacterials and antiseptics: agents, action, and resistance patterns. Clin Microbiol Rev. 2017;30(3):827-60
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing, 28th informational supplement (M100-S28) Wayne, PA, USA: Clinical and Laboratory Standards Institute; 2018.
Seah C, Alexander DC, Louie L, Simor A, Low DE, Longtin J, Melano RG. MupB, a new high-level mupirocin resistance mechanism in Staphylococcus aureus. Antimicrob Agents Chemother. 2012;56(4):1916-20.
The European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters. [(accessed on 10 November 2016)]; Available online: http://www.eucast.org/clinical_breakpoints/
Chen HJ, Hung WC, Tseng SP, Tsai JC, Hsueh PR, Teng LJ. Fusidic acid resistance determinants in Staphylococcus aureus clinical isolates. Antimicrob Agents Chemother. 2010;54(12):4985-91.
Woodford N, Afzal-Shah M, Warner M, Livermore DM. In vitro activity of retapamulin against Staphylococcus aureus isolates resistant to fusidic acid and mupirocin. J Antimicrob Chemother. 2008;62(4):766-8.
Yu F, Liu Y, Lu C, Lv J, Qi X, Ding Y, Li D, Huang X, Hu L, Wang L. Dissemination of fusidic acid resistance among Staphylococcus aureus clinical isolates. BMC Microbiol. 2015;15:210.
Huang J, Ye M, Ding H, Guo Q, Ding B, Wang M. Prevalence of fusB in Staphylococcus aureus clinical isolates. J Med Microbiol. 2013;62(Pt 8):1199-203.
Chen S, Jin Y, Lin C, Hao Z, Duan J, Guo Y, Wang S, Hu L, Wang L, Yu F. Low prevalence of mupirocin resistance among Staphylococcus aureus clinical isolates from a Chinese tertiary hospital. J Med Microbiol. 2019;68(2):201-5.
Liu QZ, Wu Q, Zhang YB, Liu MN, Hu FP, Xu XG, Zhu DM, Ni YX. Prevalence of clinical meticillin-resistant Staphylococcus aureus (MRSA) with high-level mupirocin resistance in Shanghai and Wenzhou, China. Int J Antimicrob Agents. 2010;35(2):114-8.
Traczewski MM, Brown SD. Proposed MIC and disk diffusion microbiological cutoffs and spectrum of activity of retapamulin, a novel topical antimicrobial agent. Antimicrob Agents Chemother. 2008;52(11):3863-7.
He C, Xu S, Zhao H, Hu F, Xu X, Jin S, Yang H, Gong F, Liu Q. Leukotoxin and pyrogenic toxin superantigen gene backgrounds in bloodstream and wound Staphylococcus aureus isolates from eastern region of China. BMC Infect Dis. 2018;18(1):395.
Yang JA, Park DW, Sohn JW, Yang IS, Kim KH, Kim MJ. Molecular analysis of isoleucyl-tRNA synthetase mutations in clinical isolates of methicillin-resistant Staphylococcus aureus with low-level mupirocin resistance. J Korean Med Sci. 2006;21(5):827-32.
Castanheira M, Watters AA, Bell JM, Turnidge JD, Jones RN. Fusidic acid resistance rates and prevalence of resistance mechanisms among Staphylococcus spp. isolated in North America and Australia, 2007-2008. Antimicrob Agents Chemother. 2010;54(9):3614-7.
LaMarre J, Mendes RE, Szal T, Schwarz S, Jones RN, Mankin AS. The genetic environment of the cfr gene and the presence of other mechanisms account for the very high linezolid resistance of Staphylococcus epidermidis isolate 426-3147L. Antimicrob Agents Chemother. 2013;57(3):1173-9.
Haroche J, Allignet J, Buchrieser C, El Solh N. Characterization of a variant of vga(A) conferring resistance to streptogramin A and related compounds. Antimicrob Agents Chemother. 2000;44(9):2271-5.
Tsiodras S, Gold HS, Sakoulas G, Eliopoulos GM, Wennersten C, Venkataraman L, Moellering RC, Ferraro MJ. Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet, 2001;358(9277):207-8.
McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol. 2003;41(11):5113-20.
Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38(3):1008-15.
Khoshnood S, Heidary M, Asadi A, Soleimani S, Motahar M, Savari M, Saki M, Abdi M. A review on mechanism of action, resistance, synergism, and clinical implications of mupirocin against Staphylococcus aureus. Biomed Pharmacother. 2019;109:1809-18.
Hetem DJ, Bonten MJ. Clinical relevance of mupirocin resistance in Staphylococcus aureus. J Hosp Infect. 2013;85(4):249-56.
Lee AS, Gizard Y, Empel J, Bonetti EJ, Harbarth S, François P. Mupirocin-induced mutations in ileS in various genetic backgrounds of methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2014;52(10):3749-54.
Antonio M, McFerran N, Pallen MJ. Mutations affecting the Rossman fold of isoleucyl-tRNA synthetase are correlated with low-level mupirocin resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 2002;46(2):438-42.
O'Neill AJ, McLaws F, Kahlmeter G, Henriksen AS, Chopra I. Genetic basis of resistance to fusidic acid in staphylococci. Antimicrob Agents Chemother. 2007;51(5):1737-40.
Liu Y, Geng W, Yang Y, Wang C, Zheng Y, Shang Y, Wu D, Li X, Wang L, Yu S, et al. Susceptibility to and resistance determinants of fusidic acid in Staphylococcus aureus isolated from Chinese children with skin and soft tissue infections. FEMS Immunol Med Microbiol. 2012;64(2):212-8.
Farrell DJ, Castanheira M, Chopra I. Characterization of global patterns and the genetics of fusidic acid resistance. Clin Infect Dis. 2011;52 Suppl 7:S487-92.
Nagaev I, Björkman J, Andersson DI, Hughes D. Biological cost and compensatory evolution in fusidic acid-resistant Staphylococcus aureus. Mol Microbiol. 2001;40(2):433-9.
Lannergård J, Norström T, Hughes D. Genetic determinants of resistance to fusidic acid among clinical bacteremia isolates of Staphylococcus aureus. Antimicrob Agents Chemother 2009;53(5):2059-65.
Besier S, Ludwig A, Brade V, Wichelhaus TA. Molecular analysis of fusidic acid resistance in Staphylococcus aureus. Mol Microbiol. 2003;47(2):463-9.
Rijnders MI, Wolffs PF, Hopstaken RM, den Heyer M, Bruggeman CA, Stobberingh EE. Spread of the epidemic European fusidic acid-resistant impetigo clone (EEFIC) in general practice patients in the south of The Netherlands. J Antimicrob Chemother. 2012;67(5):1176-80.
Chen CM, Huang M, Chen HF, Ke SC, Li CR, Wang JH, Wu LT. Fusidic acid resistance among clinical isolates of methicillin-resistant Staphylococcus aureus in a Taiwanese hospital. BMC Microbiol. 2011;11:98.
Castanheira M, Watters AA, Mendes RE, Farrell DJ, Jones RN. Occurrence and molecular characterization of fusidic acid resistance mechanisms among Staphylococcus spp. from European countries (2008). J Antimicrob Chemother. 2010;65(7):1353-8.
Harrington AT, Black JA, Clarridge JE 3rd. In vitro activity of retapamulin and antimicrobial susceptibility patterns in a longitudinal collection of methicillin-resistant Staphylococcus aureus isolates from a veterans affairs medical center. Antimicrob Agents Chemother. 2015;60(3):1298-303.
McNeil JC, Hulten KG, Kaplan SL, Mason EO. Decreased susceptibilities to retapamulin, mupirocin, and chlorhexidine among Staphylococcus aureus isolates causing skin and soft tissue infections in otherwise healthy children. Antimicrob Agents Chemother. 2014;58(5):2878-83.
Saravolatz LD, Pawlak J, Saravolatz SN, Johnson LB. In vitro activity of retapamulin against Staphylococcus aureus resistant to various antimicrobial agents.Antimicrob Agents Chemother. 2013;57(9):4547-50.
Takano T, Hung WC, Shibuya M, Higuchi W, Iwao Y, Nishiyama A, Reva I, Khokhlova OE, Yabe S, Ozaki K, et al. A new local variant (ST764) of the globally disseminated ST5 lineage of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) carrying the virulence determinants of community-associated MRSA. Antimicrob Agents Chemother. 2013;57(4):1589-95.
Nakaminami H, Noguchi N, Ito A, Ikeda M, Utsumi K, Maruyama H, Sakamoto H, Senoo M, Takasato Y, Nishinarita S. Characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals in Tokyo, Japan. J Infect Chemother. 2014;20(8):512-5.

Prevalence and molecular characterization of methicillin-resistant Staphylococcus aureus with mupirocin, fusidic acid and/or retapamulin resistance

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods