Study site
The study was conducted at the largest pig abattoir that supplies unprocessed pork to consumers in the city of Nairobi. The abattoir is located at the outskirts of Nairobi and obtains pigs from all production regions in Kenya.
Sampling and data collection
A total of 700 blood samples were collected from pigs in a prevalence study on pig cysticercosis as previously described (16). All pigs presented for slaughter from the months of October to December 2014 were eligible for sampling(16). Based on the data available from Kenya at the time of the parent study design, assumed prevalence of 32.8% was used with 95% confidence level and a precision of 5% to obtain an adequate sample size for the estimation of the population prevalence of cysticercosis (16). Pigs were systematically selected; the first pig presented for slaughter was sampled, followed by every fifth to get an average of 15 pigs each day for 47 days. Approximately 10 ml of blood were collected from each pig into a plain vacutainer tube (BD Vacutainer). A brief questionnaire was administered to the pig owner (farmers or traders), to capture information including the origin/location, sex and age of the sampled pigs. The blood samples were temporarily stored at 2–8 °C before transportation to the International Livestock Research Institute (ILRI) laboratories in Nairobi, Kenya. The samples were then centrifuged at 2500 rpm for 20 minutes and serum aliquoted into 2 ml sample tubes for storage at -80 °C until testing.
Serological testing
Rose Bengal Test (RBT)
The Rose Bengal antigen test (RBT) was carried out using antigens provided by Instituto de Salud Tropical Universidad de Navarra @ Edificio CIMA AvdaPioXII, 55 E-31008 Pamplona, Spain. The testing was carried out according to the OIE protocol (10). Briefly, the serum samples and the antigen were allowed to thaw at room temperature. About 25 µl of the sample was dispensed onto the glossy side of a white tile. An equal volume of the antigen was then dispensed beside each drop of serum. Each plate was prepared with negative and positive controls also provided with the kit. The antigen and serum were immediately mixed using a wooden splint, and the plate rocked gently for four minutes. Following this, the results were then read immediately in a well-lit place, and interpreted as either positive or negative. Samples were considered positive for RBT when there was any degree of visible agglutination at four minutes (10).
Competitive Enzyme-Linked Immunosorbent Assay (cELISA) testing
The ELISA testing was done using the competitive ELISA kit, COMPELISA 400 (cELISA APHA Scientific, Weybridge-UK) for detection of anti-Brucella antibodies. The cELISA testing was conducted as per the manufacturer’s instructions as follows; all reagents and serum samples were first brought to room temperature. Serum samples (20∝ l) were added to each well of the ELISA plates that are pre-coated with purified standard sLPS antigen prepared from B. melitensis isolates and mixed with 100∝ l of the freshly prepared conjugate. Positive and negative controls were included in each test run. After incubation at room temperature for 30 minutes and constant mixing on a rotary shaker, the plates were washed five times with the wash solution. Then 100∝ l of chromogen substrate added to each of the wells, incubated at room temperature for 15 minutes and the reaction stopped by adding 100∝ l of stopping solution to each well. The Optical Density (OD) was determined using an ELISA reader (BioTek Synergy HT, BioTek Winooski, VT 05404 United States) at a wavelength of 450 nm. A plate was considered valid if the mean OD of the 6 negative controls at 450 nm was greater than 0.700 and the mean OD of the 6 positive controls was less than 0.100 (18). The difference between the OD of the positive control and the negative control also had to be equal to or greater than 0.300. A cut-off was determined using the conjugate control i.e. 60% of the mean OD of the four conjugate control wells (19,20). Any OD equal to or below the determined cut-off value was considered as being positive and values above cut-off were considered negative (18).
Molecular detection:
Sample selection
The RBT positive samples plus additional randomly selected RBT negative samples (4 RBT negative sera selected for each of the RBT positive sample), were processed for molecular testing. All the molecular testing was conducted at ILRI between November and December 2019.
Extraction and purification of DNA
Extraction of genomic DNA was done from 200 µl of the serum using QIAamp™ DNA Mini Kit, (QIAGEN, Germany), according to the manufacturer’s guidelines. Briefly, 20 µl of proteinase K and 200 µl of genomic lysis buffer were added to the source sample. The mixture was subjected to digestion, deactivation, washing and elution steps as per the manufacturer’s guidelines. The DNA quality and quantity were determined using a NanoDrop™ 2000c Spectrophotometer (ThermoFisher Scientific, USA). Stock DNA samples were stored at -20 °C until the performance of PCR.
Conventional PCR detection of Brucella DNA
Molecular identification of the genus Brucella was done using two sets of primers: B4 forward (5´-TGG CTC GGT TGC CAA TAT CAA-3´) and B5 reverse (5´-CGC GCT TGC CTT TCA GGT CTG-3), as previously reported (21). The PCR reaction mix comprised of: a final concentration of 0.5 µM for each of the primer pairs, 5 µl of the DNA template (4–20 ng/ µl) and x1 concentration of the PCR mastermix (AccuPower PCR PreMix Bioneer Corp, Republic of Korea) to a final volume of 25 µl. After the initial denaturation step of 5 minutes at 95 °C in a thermo-cycler (Applied Biosystems SimpliAmp Thermo Cycler, Lite Technologies, Singapore), 35 cycles of denaturation at 94 °C for 1minute, annealing at 53 °C for 30seconds, extension at 72 °C for 1 minute, and final extension steps at 72 °C for 10 minutes were performed. Amplification of the target region was confirmed based on the presence of specific bands for Brucella (223 bp). The PCR products (3 µl) were analysed on a 1.8% agarose gel pre-stained with GelRed nucleic acid stain (Biotium Inc., USA) run at 6.7 v/cm2 for 30 minutes for electrophoresis detection and visualization with a bioanalytical imaging system (Azure Biosystems Inc., USA).
Real-time PCR detection of Brucella DNA
Real-time PCR was performed on all the extracted DNA samples using an ABI 7500 thermocycler machine (Applied Biosystems, Life Technologies, Singapore), beginning with a Brucella genus-level screening using two primers targeting IS711 gene and bcsp31 gene, respectively (13,14). The species identification using B. abortus and B. melitensis specific primers and probes, was subsequently performed on DNA samples that showed any amplification with both targets bcsp31 and IS711 primers. This second round multiplex qPCR was performed using previously developed oligonucleotide primers and probes (14) as indicated in Table 1 below. Briefly, template DNA (4 µl) were mixed with 0.5 µm concentration of the primers targeting the alk B for Brucella abortus, BMEI1162 for B. melitensis and a fluorescent probe of 0.25 µm concentration (primer and probe sequences are given in Table 1). About 10 µl of the Luna® Universal Probe qPCR mastermix (404 with UDG; New England BioLabs, MA, USA) was added to each oligonucleotide and DNA sample mixture. The reaction mixture (20 µl) was then run on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, USA). All the samples and control mixtures were tested in duplicate using the following parameters: 2 minutes of decontamination at 95 °C, followed by 10 minutes of denaturation and activation of polymerase at 95 °C, then 45 cycles of 95 °C for 15 seconds and 57 °C for 1 minute. A sample was considered positive if it amplified in one or both wells with a cycle threshold (Ct) values < 39. Positive controls 16M B. melitensis and 544 B. abortus (sourced from Friedrich- Loeffler-Institute, the Brucella reference lab in Germany) and non-template controls were included in all the real-time PCR runs.
Table 1
Primers and probes used for real-time PCR
Target | Gene targeted | Sequences of primers and probes (5’ -3’) | Fluorophore/ quencher | Reference |
Genus Brucella | IS711 | Forward GGC CTA CCG CTG CGA AT Reverse TTG CGG ACA GTC ACC ATA ATG Probe AAG CCA ACA CCC GGC | FAM/-MGBNFQ | Matero, 2011 |
Genus Brucella | Bcsp31 | Foward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA | 6-FAM/BHQ1 | Probert 2004 |
B. abortus | IS711 downstream of alkB | Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG | JOE/BHQ1 |
B. melitensis | IS711 downstream of BMEI1162 | Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA | Texas Red/BHQ2 |