2.1 Materials and main instruments
0.45 μm PVDF membrane,Millipore Inc. (Massachusetts, USA); Skimmed milk powder, Yili Industrial Group Co., Ltd. (Hohhot, China). BEYOCOLOR color pre-dyed protein molecular weight standard: Fermentas Inc(Canada); ECL plus luminescent kit, SDS-PAGE protein sample buffer (5 ×), Western and IP cell lysate, PMSF and BCA protein concentration determination kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China); Tris HCl / SDS (1.5 mm, pH 8.8) and Tris HCl / SDS (0.5 mm, pH 6.8) were purchased from Shanghai Biotechnology Co., Ltd.; 30% acrylamide/bis solution, glycine were purchased from Bio-RAD (California, USA); Tris alkali, SDS and ammonium persulfate were purchased from BiosharpInc.;Aβ1-42, BiosharpInc. (bs0076R, Hefei, China);Goat anti mouse IgG,Allied biology company(GAM007, Shenzheng, China); Goat anti rabbit IgG, Allied biology company (GAR007, Shenzheng, China); β-actin,Allied biology company (ab008, Beijing, China); HEK293T cells and OATP1B1 virus, Hangzhou HibioTechnology Co.,Ltd. (Hangzhou, China);fetal bovine serum, GibcoInc. (California, USA); Rapid total RNA Extraction Kit, Shanghai Jierui Bioengineering Co., Ltd. (Shanghai, China); The reverse transcription kit (HiScript II Q RT SuperMix for qPCR) and Quantitative PCR kit (ChamQTM SYBR Color Qpcr Master Mix),Vazyme Biotech Co.,Ltd. (Nanjing, China).
Flow cytometer: Becton,Dickinson and Company (New Jersey, USA); Cell incubator, Thermo Fisher Scientific (Massachusetts, USA); Inverted microscope, Olympus company (Japan). Desktop low-speed centrifuge, Shanghai medical equipment (Group) Co., Ltd.(Shanghai, China); Mini-Proten Tetra System, Bio-RAD, (California, USA); ChemiDoc XRS+ System, Bio-RAD (California, USA); Low light spectrophotometer, Beijing Meilin Hengtong Technology Co., Ltd. (Beijing, China).
2.2 Methods
HEK293T cells and OATP1B1 virus were obtained from Hangzhou HibioTechnology Co.,Ltd. (Hangzhou, China). The OATP1B1-GFP-HEK293T and GFP-HEK293T cell models were established as previously described [8]. The OATP1B1 sequence was synthesized into a pEGFP‐N1 vehicle.Then, the vehicle was transfected into DH5α competent cells to generate more pEGFP-N1-OATP1B1 plasmids. Finally, the pEGFP-N1-OATP1B1 plasmid was transfected into HEK293 cells. Then, qPCR and western blot testing were used to detect the expression of OATP1B1 in the cells [8]. The complete RNA was extracted using a Trizol centrifugal column, and reverse transcription was carried out to obtain the cDNA. Finally, a PCR system was established, and the mRNA levels ofOATP1B1-GFP-HEK293T cells and GFP-HEK293T cells were analyzed using a real-time quantitative PCR detection system. Primers for OATP1B1 were OATP1B1-F: AACTCCTACTGATTCTCGATGGG; OATP1B1-R: GTTTCCAGCACATGCAAAGAC; actin-F: TGACGTGGACATCCGCAAAG; actin-R:CTGGAAGGTGGACAGCGAGG. OATP1B1-GFP-HEK293T cells and the control cell line GFP-HEK293T were used to explore the uptake features of Aβ1-42. All HEK293 stable cell lines were maintained in dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum, 1% antibiotic, and antimycotic solution, and 600 µg.ml-1 geneticin. The cell lines were cultured in a humidified atmosphere (95% O2, 5% CO2) at 37°C. Aβ1-42was dissolved in dimethylsulfoxide (DMSO) and cell toxicity was performed to select reasonable concentrations for the uptake experiments. Next, a series of concentrations of Aβ1-42 (0, 0.4, 1.0, and 2.5µM) were added to the OATP1B1-GFP-HEK293T and GFP-HEK293 cells and incubated for approximately 24, 48, and 72 h. Then, the cells were washed with ice-coldphosphate buffer saline (PBS) 3× and lysed with cell lysis buffer. Cell lysis buffer was collected and centrifuged at 1.4×104 rpm for 20 min. The supernatants were used to analyze the Aβ1-42 by western blotting (WB). At the same time, the cells were collected to detect the uptake of Aβ1-42 in both OATP1B1-GFP-HEK293T and GFP-HEK293 cells by flow cytometry.
2.3 Statistical analysis
All statistical analyses were performed using Student’s t-test and one-way ANOVA, with SPASS 13.0. Data are presented as mean ±standard deviation from at least three separate experiments. * and ** indicate p<0.05 and p<0.01, respectively. P value less than 0.05 was considered statistically significant. Western blot bands were calculated using Image J software (Java 1.6.0_20, NIH, USA).