Uptake of Aβ by OATPs Might Be a New Pathophysiological Mechanism of Alzheimer Disease

Abstract

Background

The accumulation of neurotoxic amyloid-beta (Aβ) in the brain is a characteristic of Alzheimer's disease (AD). Over the last decade, a number of reports have shown that P-glycoprotein (encoded by ABCB1) actively mediates the efflux transport of Aβ peptides. However, the mechanism by which Aβ peptides enter the cells is not clear. We found that the protein expression oforganic anion transporting Polypeptide 2 (Oatp2) in the liver tissue of mice with AD was significantly higher than that in the normal mice. In contrast, the protein expression of Oatp2 in the brain significantly decreased in mice with AD. OATP1B1, an important drug transporter might be related to the pathophysiology of AD.

Results

In this study, we established an OATP1B1-GFP-HEK293T cell model to confirm the OATP1B1 mediated transport ofAβ_1-42.Compared to the control group of GFP-HEK293Tcells, the uptake of Aβ_1-42 protein in the OATP1B1-GFP-HEK293T group increased significantly with the increase in concentration of Aβ_1-42, and also increased significantly with an increase in the duration of incubation. Similar results were observed in the flow cytometry experiment, and the uptake of Aβ_1-42in HEK239T-OATP1B1 cells was almost twice that in the control group. These results indicate that OATP1B1 acts as an important “carrier” for the transport of Aβ_1-42 from the blood to the tissues, including liver and brain.          

Conclusions

This is a novel and interesting finding and OATP1B1 can be investigated as a new treatment target for AD.

1. Introduction

Alzheimer's disease (AD) is a neurodegenerative disease characterized by progressive loss of memory and acquired knowledge, until the complete loss of activities of daily life. Alzheimer's disease endangers the health of the elderly following cardiovascular disease, cerebrovascular disease, and tumor [1]. According to the data released by the International Alzheimer's Association (ADI) in 2018, there are currently about 44.40 × 10⁶ patients with AD in the world, with an average of 1 new case detected every 3 seconds [2]. According to the statistics of the World Health Organization, AD will become the fourth highest cause of disease burden in China by 2020. This could lead to a heavy healthcare burden on the society and families, and develop into a serious social and health problem.

Although many scholars think that neurotoxicity caused by amyloid-beta (Aβ) is one of the main causes of AD, the exact pathogenesis of AD remains elusive. Currently, there is no effective method to treat or prevent the progression of AD. Therefore, it is imperative to understand the etiology, pathogenesis, and treatment target for AD as soon as possible, and to discover safe and effective treatment approaches in the field of AD research. It has been suggested that the imbalance between the clearance of Aβ and its accumulation in the peripheral and central systems is at the core of the development of AD [3]. However, the mechanism for correcting this imbalance is not clear. In recent years, drug transporters have played a very important role in the development of drugs, endogenous substances, and disease pathophysiology. Are these transporters related to the occurrence and development of AD? It has been shown that P-glycoprotein (P-gp，ABCB1) is an important barrier for the peripheral and central clearance of Aβ [4,5], and these exosomes can reduce the accumulation of Aβ in the tissues. However, a previous study showed that the ATPase activity measured in the vesicles of the plasma membrane of K562 cells overexpressing P-gp was not increased by the presence of Aβ₄₂, suggesting that Aβ₄₂ is not a P-gp substrate [6]. Similarly, P-gp of pirarubicin was unaffected by the expression of Aβ₄₂. Moreover, the overexpression of P-gp does not protect the cells against Aβ₄₂ toxicity[6]. Considered together, these results indicate that Aβ₄₂ is not transported by P-gp [6].Therefore, although much evidence from human, animal, and in vitro studies has examined the contribution of P-gp in the clearance of Aβ, the role of P-gp in AD is still contentious [7].

All previous studies focused on the efflux transporter of P-gp, but whether uptake transporters play a role in the pathophysiology of AD is unknown. As an important member of the solute delivery protein family, OATP has a wide range of substrates, including a variety of internal and external substances, especially the process of drugs in vivo, and its coding genes are collectively referred to as SLCO genes [8]. Among them, the specific expression of OATP1B1 (mouse hepatocyte expression homologous gene Oatp2) in the basement membrane of human hepatocytes has been widely studied, and its mediated substrate transport (drug) is very extensive [9]. Our research group tried to explore whether there is a relationship between OATPlevels and AD. In a previous study, we analyzed the brain and liver tissue of mice with AD, and found that the protein expression of Oatp2 in the brain significantly decreased in the affected mice [9]. In contrast, the protein expression of Oatp2 in the liver tissue of mice with AD was significantly higher than that in the normal mice [9]. Results for the mRNA expression of Oatp2 showed that compared to that in the normal mice, it was significantly lower in the brain but significantly higher in the liver tissue in mice with AD [9]. However, the study could not confirm the relationship between Oatp2 and AD. Therefore, this study aimed to confirm whether OATPs mediate the transport of Aβ_1-42. This is a very novel and interesting study that might open a new door for research on the pathophysiology of AD.

2. Materials And Methods

2.1 Materials and main instruments

0.45 μm PVDF membrane,Millipore Inc. (Massachusetts, USA); Skimmed milk powder, Yili Industrial Group Co., Ltd. (Hohhot, China). BEYOCOLOR color pre-dyed protein molecular weight standard: Fermentas Inc(Canada); ECL plus luminescent kit, SDS-PAGE protein sample buffer (5 ×), Western and IP cell lysate, PMSF and BCA protein concentration determination kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China); Tris HCl / SDS (1.5 mm, pH 8.8) and Tris HCl / SDS (0.5 mm, pH 6.8) were purchased from Shanghai Biotechnology Co., Ltd.; 30% acrylamide/bis solution, glycine were purchased from Bio-RAD (California, USA); Tris alkali, SDS and ammonium persulfate were purchased from BiosharpInc.;Aβ_1-42, BiosharpInc. (bs0076R, Hefei, China)；Goat anti mouse IgG,Allied biology company(GAM007, Shenzheng, China); Goat anti rabbit IgG, Allied biology company (GAR007, Shenzheng, China); β-actin,Allied biology company (ab008, Beijing, China); HEK293T cells and OATP1B1 virus, Hangzhou HibioTechnology Co.,Ltd. (Hangzhou, China);fetal bovine serum, GibcoInc. (California, USA); Rapid total RNA Extraction Kit, Shanghai Jierui Bioengineering Co., Ltd. (Shanghai, China); The reverse transcription kit (HiScript II Q RT SuperMix for qPCR) and Quantitative PCR kit (ChamQTM SYBR Color Qpcr Master Mix)，Vazyme Biotech Co.,Ltd. (Nanjing, China).

Flow cytometer: Becton,Dickinson and Company (New Jersey, USA); Cell incubator, Thermo Fisher Scientific (Massachusetts, USA); Inverted microscope, Olympus company (Japan). Desktop low-speed centrifuge, Shanghai medical equipment (Group) Co., Ltd.(Shanghai, China); Mini-Proten Tetra System, Bio-RAD, (California, USA); ChemiDoc XRS+ System, Bio-RAD (California, USA); Low light spectrophotometer, Beijing Meilin Hengtong Technology Co., Ltd. (Beijing, China).

2.2 Methods

HEK293T cells and OATP1B1 virus were obtained from Hangzhou HibioTechnology Co.,Ltd. (Hangzhou, China). The OATP1B1-GFP-HEK293T and GFP-HEK293T cell models were established as previously described [8]. The OATP1B1 sequence was synthesized into a pEGFP‐N1 vehicle.Then, the vehicle was transfected into DH5α competent cells to generate more pEGFP-N1-OATP1B1 plasmids. Finally, the pEGFP-N1-OATP1B1 plasmid was transfected into HEK293 cells. Then, qPCR and western blot testing were used to detect the expression of OATP1B1 in the cells [8]. The complete RNA was extracted using a Trizol centrifugal column, and reverse transcription was carried out to obtain the cDNA. Finally, a PCR system was established, and the mRNA levels ofOATP1B1-GFP-HEK293T cells and GFP-HEK293T cells were analyzed using a real-time quantitative PCR detection system. Primers for OATP1B1 were OATP1B1-F: AACTCCTACTGATTCTCGATGGG; OATP1B1-R: GTTTCCAGCACATGCAAAGAC; actin-F: TGACGTGGACATCCGCAAAG; actin-R:CTGGAAGGTGGACAGCGAGG. OATP1B1-GFP-HEK293T cells and the control cell line GFP-HEK293T were used to explore the uptake features of Aβ_1-42. All HEK293 stable cell lines were maintained in dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum, 1% antibiotic, and antimycotic solution, and 600 µg.ml-1 geneticin. The cell lines were cultured in a humidified atmosphere (95% O2, 5% CO2) at 37°C. Aβ_1-42was dissolved in dimethylsulfoxide (DMSO) and cell toxicity was performed to select reasonable concentrations for the uptake experiments. Next, a series of concentrations of Aβ_1-42 (0, 0.4, 1.0, and 2.5µM) were added to the OATP1B1-GFP-HEK293T and GFP-HEK293 cells and incubated for approximately 24, 48, and 72 h. Then, the cells were washed with ice-coldphosphate buffer saline (PBS) 3× and lysed with cell lysis buffer. Cell lysis buffer was collected and centrifuged at 1.4×104 rpm for 20 min. The supernatants were used to analyze the Aβ_1-42 by western blotting (WB). At the same time, the cells were collected to detect the uptake of Aβ_1-42 in both OATP1B1-GFP-HEK293T and GFP-HEK293 cells by flow cytometry.

2.3 Statistical analysis

All statistical analyses were performed using Student’s t-test and one-way ANOVA, with SPASS 13.0. Data are presented as mean ±standard deviation from at least three separate experiments. * and ** indicate p<0.05 and p<0.01, respectively. P value less than 0.05 was considered statistically significant. Western blot bands were calculated using Image J software (Java 1.6.0_20, NIH, USA).

3. Results

We successfully created an OATP1B1-GFP-HEK293T cell model and compared it to the control. OATP1B1 increased by approximately 214% in the OATP1B1-GFP-HEK293T cells (Figure 1). The qPCR results also showed that the mRNA expression of OATP1B1 in the OATP1B1-GFP-HEK293T cells was significantly higher than that in the GFP-HEK239T cells (1.03±0.22 vs 0.00±0.00). After treatment withAβ_1-42 (0, 0.4, 1, 2.5 μM) for 24, 48, and 72 h, by using western blotting, the uptake of Aβ_1-42 inOATP1B1-GFP-HEK293T cells significantly increased with increasingAβ_1-42 concentration and the duration of incubation. Similar results were also seen in the HEK293T cells; however, OATP1B1-GFP-HEK293T cells mediated uptake of Aβ_1-42 was higher than that of GFP-HEK293 cells, especially when the incubation time was 72 h (Figure 2). From the gray value of the western blot, the results showed that Aβ_1-42 uptake in GFP-HEK239T cells and OATP1B1-GFP-HEK293T cells was 0.11 vs 0.10, 0.38 vs 0.52, 0.56 vs. 0.83, 0.62 vs 0.93 when the cells were treated with Aβ_1-42 (0, 0.4, 1, and 2.5 μM) for 24 h, while theywere 0.09 vs 0.12, 0.40 vs 0.87, 0.46 vs 0.97, 0.68 vs 1.24 for 48 hours, and 0.08 vs 0.07, 0.47 vs 0.66, 0.69 vs 1.49, 0.92 vs. 2.16 for 72 h (Figure 3).

From the results of flow cytometry (Figure 4), we observed thatthe uptake of Aβ_1-42 increased both GFP-HEK239T and OATP1B1-GFP-HEK293T cells, and compared to the HEK293T cells, the uptake of Aβ_1-42 in OATP1B1-GFP-HEK293T cells increased significantly with the increase in the duration of incubation (Figure 5 and Table 1). By calculating the fluorescence intensity of Aβ_1-42 in the GFP-HEK239T and OATP1B1-GFP-HEK293T cells, it is apparent that the intensity of Aβ_1-42 in OATP1B1-GFP-HEK293T cells was higher than that in GFP-HEK239T cells. The results are shown in Figure 6 and Table 2. Results of both western blotting and flow cytometry confirmed that Aβ_1-42 was the substrate of OATP1B1. OATP1B1 is involved in the transport of Aβ_1-42 in tissues.

4. Discussion

One study demonstrated that endocytosis is the major, if not the only pathway for the entry of Aβ_1-40 and Aβ_1-42 into the SH-SY5Y cells [10]. This disputes some previous beliefs about passive diffusion or membrane-penetration modes of entry, which would allow Aβ direct access to the cytoplasm [11]. Simultaneously, the clearance of cerebral Aβ is a complex process mediated by various systems and cell types, including vascular transport across the blood–brain barrier, glymphatic drainage, and engulfment and degradation by the resident microglia and infiltrating innate immune cells[12]. Therefore, the process for the uptake and efflux of Aβ is complex and chaotic. Our study showed that Aβ_1-42 was the substrate of OATP1B1, which is a novel and interesting finding. As an uptake transporter that might play an important role in the cellular uptake of Aβ_1-42, OATP1B1will become a new target for the treatment of AD. We found that the protein expression of Oatp2 (OATP1B1) in the liver tissue of mice with AD was significantly higher than that in the normal mice. In contrast, the protein expression of Oatp2 in the brain was significantly lower in mice with AD [9]. OATP1B1 might have a “self-defense system role” that could decrease the uptake quantity of Aβ_1-42 in the blood and decrease the uptake of Aβ_1-42 in brain. At the same time, it is necessary to confirm whether other members of the OATPs families act as a “carrier” of Aβ_1-42. Despite decades of research, the pathophysiology of AD remains elusive. Understanding the normal versus impaired processing and clearance mechanisms affecting Aβ peptides will assist in the development of more effective therapeutic agents to combat this progressive neurodegenerative condition that continues to devastate millions of patients globally [7].We hope that this study will be helpful in the research for the pathophysiology of AD. The active uptake pathway for the entry of Aβ_1-40 and Aβ_1-42 into the nerve cells by the OATPs is likely to become a new and novel mechanism of the pathophysiology of AD.

Abbreviations

AD: Alzheimer's disease;organic anion transporting Polypeptide: OATP; Aβ: amyloid-beta ;

Declarations

This manuscript has not been published or presented elsewhere in part or in entirety and is not under consideration by another journal. The study design was approved by the appropriate ethics review board. All authors have approved the manuscript for submission. We have read and understood your journal’s policies, and we believe that neither the manuscript nor the study violates any of these. The authors declare that they have no conflicts of interest.

Acknowledgements

We would like to thank professor Tan Jun for excellent technical assistance.

Authors’ contributions

Jinhua Wen and Ying Zhou designed and conducted the experiment; Yanni Lv and Menghua Zhao completed the experiments of western blot and flow cytometry. Jinhua Wen wrote the manuscript.

Availability of data and materials

The data used can be found in Additional file.

Consent for publication

Not applicable.

Competing interests

We declare that they have no conflicts of interest.

Funding

This study was supported by the National Natural Science Foundation of China (81660620, 81860661, 81202583) and the Department of Science and Technology of Jiangxi Province (20171ACB21059, 20192BCBL23018).

References

1. Stower H. Meningeal lymphatics in aging and Alzheimer's disease[J].Nat Med. 2018; 24(12):1781.
2. World Alzheimer Report 2018 The state of the art of dementia research: New frontiers Published by Alzheimer's Disease International (ADI), London. September 2018 Copyright © Alzheimer’s Disease International.
3. Tarasoff-Conway JM, Carare RO, Osorio RS, Glodzik L, Butler T, Fieremans E, Axel L, Rusinek H, Nicholson C, Zlokovic BV, Frangione B, Blennow K, Ménard J, Zetterberg H, Wisniewski T, de Leon MJ. Clearance systems in the brain-implications for Alzheimer disease. Nat Rev Neurol. 2015; 11(8),457-70.
4. Zuroff L, Daley D, Black KL, Koronyo-Hamaoui M. Clearance of cerebral Aβ in Alzheimer's disease: reassessing the role of microglia and monocytes.Cell Mol Life Sci. 2017; 74(12):2167-2201.
5. Sita G, Hrelia P, Tarozzi A, Morroni F.P-glycoprotein (ABCB1) and Oxidative Stress: Focus on Alzheimer's Disease.Oxid Med Cell Longev. 2017; 2017: 7905486.
6. BelloI,  Salerno Evidence Against a Role of P-glycoprotein in the Clearance of the Alzheimer's Disease Aβ1-42 Peptides. Cell Stress Chaperones. 2015; 20(3): 421-30.
7. Chai AB,  Leung GKF ,  Callaghan R,  Gelissen P-glycoprotein: A Role in the Export of Amyloid-β in Alzheimer's Disease? FEBS J. 2020; 287(4): 612-625 .
8. CaoL, Zhou J,  Wen Transport of Salvianolic Acid B via the Human Organic Anion Transporter 1B1 in the Liver [J]. Phytother Res. 2019; 33(1):197-204.
9. WenJ, Zhao M,  Liu Expression of Oatp2 in the Brain and Liver of Alzheimer Disease Mouse Model. ACS Chem Neurosci. 2020; 11(3):226-227.
10. Wesén E,  Jeffries GDM,  Dzebo MM,  Esbjörner Endocytic Uptake of Monomeric Amyloid-β Peptides Is Clathrin- And Dynamin-Independent and Results in Selective Accumulation of Aβ (1-42) Compared to Aβ(1-40). Scientific Reports. 2017;7(1):2021.
11. Omtri RS, Davidson MW, Arumugam B, Poduslo JF, Kandimalla KK. Differences in the cellular uptake and intracellular itineraries of amyloid beta proteins 40 and 42: ramifications for the Alzheimer’s drug discovery. Mol. Pharm. 2012; 9:1887-1897.
12. Zuroff L, Daley D, Black KL, Koronyo-Hamaoui M. Clearance of cerebral Aβ in Alzheimer’s disease: reassessing the role of microglia and monocytes.Cell. Mol. Life Sci. 2017; 74: 2167–2201.

Tables

Table 1 The cellular uptake of Aβ_1-42 in GFP-HEK239T cells and OATP1B1-GFP-HEK293T cells following incubation with 0.4, 1, 2.5 μM Aβ_1-42 for 24, 48, 72h, respectively.

NC: GFP-HEK239T cells ; OATP1B1:OATP1B1-GFP-HEK293T cells.*P<0.05;**P<0.01.

Table 2 Fluorescence intensity of Aβ_1-42 in the GFP-HEK239T and OATP1B1-GFP-HEK293T cells when the cells were treated with different concentration of Aβ_1-42 during the different incubation time.

NC:GFP-HEK239T cells ; OATP1B1:OATP1B1-GFP-HEK293T cells.