Colorectal cancer tissues
Thirty-six cancer tissues and paired tissues were collected from CRC patients with complete pathological and clinical data who were hospitalized and treated surgically in Nanjing First Hospital from January 2015 to January 2020. Adjacent tissue was taken from a distance of more than 5 cm from cancerous tissue, and intraoperative pathological slices were pathologically confirmed to be free of cancer. There were 21 males and 15 females, aged (61.6±7.7) years, with an age range of 51-72 years. Inclusion criteria: ①surgically resected specimens were pathologically confirmed; ②all patients with colorectal cancer did not receive anti-cancer treatment such as chemotherapy, radiotherapy, immunotherapy, and targeted therapy before surgery; ③clinical and pathological data of CRC patients were complete; ④all patients gave informed consent. Besides, CRC patients with other malignant tumors, systemic infections, immunodeficiency, immune diseases, coagulation dysfunction, serious heart, liver, or kidney diseases were excluded. All patients signed informed consent form prior to surgery, and the study was approved by the Ethics Committee of Nanjing First Hospital. Table 1 lists patient characteristics.
Table 1
The clinicopathological characteristics of patients with colorectal cancer (36 cases).
Characteristics
|
Number of cases (%)
of cases(%)
|
Age (year)
|
|
≤60
|
15 (41.67)
|
>60
|
21 (58.33)
|
Gender
|
|
Male
|
17 (47.22)
|
Female
|
19 (52.78)
|
TNM stage
|
|
Ⅰ+Ⅱ
|
20 (55.56)
|
Ⅲ
|
16 (44.44)
|
Recurrence
|
|
No
|
17 (47.22)
|
Yes
|
19 (52.78)
|
Distant metastasis
|
|
M0
|
12 (33.33)
|
M1+M2
|
24 (66.67)
|
Cell culture and lentivirus infection
Human colorectal cancer cell lines LoVo, Caco2, HCT116, SW480, normal human colon epithelial cells CCD841CoN, and 293T cells were obtained from the American Type Culture Collection (ATCC). LoVo cells were maintained in Ham’s F-12 culture medium with 10% FBS (Gibco) and 1% penicillin/streptomycin (P/S). Caco2, HCT116, SW480 and 293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) containing 10% FBS and 1% P/S. CCD841CoN cells were cultured in minimum essential medium (MEM) with 10% FBS and 1% P/S. All cells were kept in 5% CO2 incubator at 37℃. LINC01088 silencing lentivirus (sh1-01088 and sh2-01088), G3BP1-overexpressing lentivirus and the control lentivirus were constructed by Shanghai GeneChem Co., Ltd. (China). CRC cells were infected with shRNA lentivirus or/and G3BP1-overexpressing lentivirus or control lentivirus at 10 MOI for 24 h following 7-days puromycin (2 μg/ml) selection. LINC01088 knockdown efficiency in the infected cells was validated by qRT-PCR.
Fluorescence in situ hybridization (FISH) assay
Fluorescence in situ hybridization (FISH) assay was conducted using RNA FISH Kit (Shanghai GenePharma Co., Ltd, China) according to the manufacturer’s protocol. All sequences used were listed below. 5’-Cy3-labeled LINC01088 homo probe 1 (5’-3’): GCAGTACTAACTCATCCAGTATCTGATTC; 5’-Cy3-labeled LINC01088 homo probe 2 (5’-3’): GGCGGCAGCAAGAAGCAGTTCTAAT; 5’-Cy3-labeled LINC01088 homo probe 3 (5’-3’): CTTTGCATCCATCATTCAACGAAAT; 5’-FAM-labeled 18S (5’-3’): CTGCCTTCCTTGGATGTGGTAGCCGTTTC; 5’-FAM-labeled U6 (5’-3’): TTTGCGTGTCATCCTTGCG; 5’-Cy3-labeled negative control sequence (5’-3’): TGCTTTGCACGGTAACGCCTGTTTT.
Transfection experiments
Small interfering RNA (siRNA) oligonucleotides including the control scrambled siRNA were ordered from Sangon Biotech (Shanghai) Co., Ltd. (China). Transient transfection of siRNA was performed with Lipofectamine™ RNAiMAX Transfection Reagent according to manufacturer’s instructions (Invitrogen, cat no.13778500). The RNA-lipid complexes were prepared, vortexed and allowed to incubate for 5 min at room temperature (RT). Next, the mixture was added into the cells followed by incubation for 24 h at 37 ℃. The efficiency of siRNA interference was determined by qRT-PCR analysis 48 hours post-transfection.
Nucleo-cytoplasmic separation experiment
Nucleo-cytoplasmic fractions were isolated using PARISTM Kit following manufacturer instructions. Briefly, adherent cells (107 cells per experiment) were harvested until they were grown to ~90% confluence, transferred to 1.5 mL microfuge tubes, and centrifuged at 180×g for 4 min at 4 ℃. Next, the supernatant was discarded. 500 μl of ice-cold Cell Fractination Buffer was added. Tubes were then placed on ice for 7 min. After centrifugation at 500×g for 4 min at 4 ℃, the supernatant (cytoplasmic fraction) was transferred to a new RNase-free 1.5 mL EP tube. The pellet contained nuclear fraction. Total nuclear or cytoplasmic RNA was extracted, respectively. RNA samples were stored at -80℃ or kept on ice when in use.
Cell Counting Kit-8 (CCK-8) assay
The cells were inoculated into 96-well dishes at a density of 3×104 cells per well, and five replicate wells were set up in each analysis. After 24 h, 48 h, 72 h and 96 h of incubation respectively, CCK-8 reagent (Sigma-Aldrich, cat no.96992) with a volume fraction of 10% was added to the cells following incubation for 2 h at 37 ℃. The plates were placed on a shaker for 5 min, and absorbance values were measured at 490 nm using Microplate reader (Bio-Rad). Growth curve was plotted with time as the horizontal coordinate and absorbance value as the vertical coordinate.
Colony-formation assay
The cells (500 cells per well) were inoculated into 6-cm culture dishes. After 2 weeks of incubation at 37 ℃, cell colonies were observed and then culture medium was discarded. Adherent cells were gently washed twice with PBS (Gibco) and fixed with 4% paraformaldehyde for 15 min at RT. After elimination of fixative solution by aspiration, cell colonies were visualized by staining with 0.1% crystal violet solution (Beyotime Biotechnology, cat no.C0121, China) for 20 min at RT. The number of colonies was counted.
Cell cycle analysis
Cell cycle was evaluated by flow cytometry. The cells in logarithmic growth phase were digested using EDTA-free trypsin (Gibco) and washed three times with pre-chilled PBS. Thereafter, 400 μl of Binding Buffer and 10 μl of PI were added sequentially to cell suspension, following reaction for 30 min under protection from light at RT. Cycle distribution was assessed using CytoFlex Flow Cytometer (Beckman Coulter).
Transwell migration and invasion assays
For transwell invasion assay, Matrigel (Corning, cat no.356234) was removed from the -20°C refrigerator and placed in an ice-water mixture to dissolve. All tips and microfuge tubes used in the experiments were pre-chilled in a 4°C refrigerator. Matrigel and serum-free basal medium were mixed thoroughly at a 1:3 ratio and then added into transwell upper chambers (Costar, 8-μm pore size) for incubation for 1 h at 37°C. In addition, cell concentration was adjusted to 5×105 cells/ml. 200 μl of the cell suspension was slowly added to the upper chambers and the lower chambers contained 500 μl of complete culture medium. Twenty-four hours later, the non-invasive cells in transwell upper chamber were wiped off with wet cotton swabs. Next, the filter was fixed with 4% formaldehyde for 10 min, stained with 0.5% crystal violet for 20 min, rinsed with PBS and air-dried. The number of invasive cells was observed microscopically, and 10 randomly chosen fields of view were imaged and counted. Transwell chambers pre-coated without Matrigel were used for transwell migration assay and workflow was followed as indicated above.
Propidium iodide (PI) staining
After 48 h of co-culture, the cells were incubated with PI staining solution (Sigma) for 5 min. Next, PI-positive cells were observed and counted under a fluorescent microscope (Nikon), while the total number of cells was observed under white light. The percentage of PI-positive cells was calculated.
Dual-luciferase reporter assay
The pmirGLO dual-luciferase vectors and dual-luciferase reporter system (Promega) were used for evaluating the interaction between LINC01088 and microRNAs according to the manufacturer’s instructions. Predicted binding sites were analyzed by https://starbase.sysu.edu.cn/starbase2/ and http://starbase.sysu.edu.cn/. The desired primer sequences were cloned into luciferase reporter plasmid as described in the instruction manual. Empty vector plasmid was as the control. 293T cells were seeded into 24-well plates and allowed to grow to 80% confluence. Reporter plasmid was co-transfected with the expression plasmid into 293T cells using Lipofectamine™ 2000 Reagent (Invitrogen). Seventy-two hours later, the proteins were extracted and Dual-Luciferase Reporter Assay System Kit (Promega) was used to test luciferase activity.
RNA immunoprecipitation (RIP) assay
RIP assay was performed using Imprint® RNA Immunoprecipitation Kit according to the manufacturer’s instructions (Sigma-Aldrich). Briefly, CRC cells with LINC01088 knockdown in logarithmic growth phase were harvested and resuspended using RIP Lysis Buffer, mixed thoroughly, and set aside on ice. After incubation for 30 min, the samples were centrifuged at 2500×g for 10 min at 4°C. Besides, magnetic beads conjugated anti‐Ago antibody or IgG for pre-clearance were washed with RIP Wash Buffer (provided with the kit). 900 µl of RIP Immunoprecipitation Buffer was added to each tube and mixed with 100 µl supernatant following incubation overnight at 4°C with rotation. After precipitating the magnetic beads, removed the supernatant, added 500 µl of RIP Wash Buffer to wash the beads, vortexed, and then collected the precipitate. 10 µl of the cell lysate supernatant was taken as "Input" and store it temporarily at -80°C. Next, 150 µl of Proteinase K Buffer was added to the precipitate obtained in the previous step. In addition, RIP Wash Buffer, 10% SDS, and Proteinase K mixture were added to the "Input" after thawing, followed by incubation for 30 min at 55℃ with shaking to digest the proteins. Total RNA for subsequent qPCR analysis was extracted from each group according to the instructions of RNA-easy Isolation Reagent (as indicated below).
qPCR analysis
Total RNA was extracted from tissues or cells using RNA-easy Isolation Reagent (Vazyme Biotech Co., Ltd, cat no. R701-01) according to the instructions and the concentration of total RNA were determined using UV spectrophotometer. cDNA was reverse transcribed using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, cat no. RR047A) or miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme Biotech Co., Ltd, cat no. MR101-01). qPCR reaction system was 20 µL: 10 µl miScript SYBR® Green Mix (QIAGEN, Dusseldorf, Germany), or 10 µl miRNA Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, cat no. MQ101-01), 2 µl cDNA, 1 µl each of forward and reverse primers, 6.0 µl ddH2O. Reaction conditions were as described below: pre-denaturation 95°C, 90 sec; denaturation 95°C, 30 sec; annealing 60°C, 30 sec; extension 72°C, 15 sec; 40 cycles in total. Gene expression was analyzed by the 2-∆∆Ct method. GAPDH was used as an internal reference gene.
Western blot analysis
Tumor cells or tissues were subjected to RIPA lysis solution containing 1% PMSF and placed on ice for 20 min. The supernatant was collected by centrifugation at 12000×g for 15 min at 4℃. Protein concentration was determined by the BCA method. Appropriate amount of protein samples was mixture with 5×loading buffer and boiled for 5 min to denature the proteins. SDS-PAGE gel electrophoresis was performed to separate the proteins, and 30 μg of denatured protein samples were added to each lane. Proteins were transferred onto the PVDF membranes (Immobilon transfer membrane, Millipore Corporation) through wet transfer. Next, the membranes were blocked with bovine serum albumin diluted with TBST for 2 h at RT and incubated with primary antibody at 4℃ overnight. The secondary antibody was then added and incubated for 2 h at RT. Immunoblots were visualized using Immobilon Western Chemiluminescent HRP Substrate (ECL) (Millipore). β-actin protein was used as internal control.
Animal experiments
To test proliferative ability of CRC cells in vivo, tumor cells in logarithmic growth phase were resuspended in PBS and cell concentration was adjusted to 1×107 cells/ml. BALB/c female nude mice of age 5 weeks and weighing about 20 g were acclimated for one week prior to experiments. 100 μl of cell suspension was subcutaneously injected into the right axilla of nude mouse (N=6 mice per group). Tumor diameters of xenograft mice were measured weekly after inoculation. Tumor volume was calculated by the formula: tumor volume = width2×length/2 Mice were sacrificed under anesthesia 35 or 42 days after inoculation, and tumor tissues were photographed and weighed after stripping and removing the surrounding connective tissues. Besides, to measure lung metastatic capability of LINC01088-knockdown CRC cells in vivo, CRC cell concentration of each group was adjusted to 1×106 cells/ml. 50 μl of the cell suspension was injected into the mice through the lateral tail vein of the nude mice (N=6 mice per group) and lung metastatic nodules were examined at the desired time point after deep anesthesia with isoflurane. Lung tissues were collected for HE staining. All animal experiments were conducted under the approval of Animal Care and Use Committee of Nanjing First Hospital.
Human colorectal cancer tissue-derived organoids
This study was approved by the Ethics Committee of Nanjing First Hospital. The patient signed informed consent form prior to surgery. Fresh colorectal cancer tissues were collected after surgical resection and maintained in ice-cold DMEM/F-12 medium with 15 mM HEPES (Gibco) within 2 hours. Tissues were cut into 1-3 mm3 pieces, washed ten times using pre-chilled PBS, and digested with Gentle Cell Dissociation Reagent (GCDR) (Stemcell Technologies, cat no.07174) for 50 min at 37°C with shaking. After centrifugation at 300×g for 5 min, the supernatant was discarded. The tissues were resuspended using DMEM/F-12 medium with 15 mM HEPES and 2% BSA (Solarbio Life Science, cat no.9048-46-8) and filtered through 70-μm strainers. The number of intestinal crypts were counted. Next, Matrigel Matrix Growth Factor Reduced (GFR), Red-free (Corning, cat no.356231) was diluted with DMEM/F-12 complete medium (as indicated above) at a 1:1 ratio and the crypts were resuspended. Matrigel containing intestinal crypts was dropped onto the center of a pre-warmed 24-well plate without medium (50 μl/well). The plate was placed in an incubator at 37℃ for 10 min. Subsequently, human organoid medium IntestiCult OGM (Stemcell Technologies, cat no. A8010) was added and was changed every 2-3 days. Passaging was performed 8 days after culturing.
Isolation, characterization and cultivation of human CD8+T cells
Fresh blood from a healthy donor was transferred into a blood draw tube containing heparin anticoagulant and mixed upside down. PBS supplemented with 2% FBS (PBST) was added to dilute the blood at a 1:1 ratio. Subsequently, an equal volume of Lymphocyte Separation Solution (Solarbio Life Science, catalog #P8610/P8900) was added to the bottom of SepMateTM-50 tube (Stemcell Technologies, catalog #15450). The diluted blood sample was aspirated and slowly spread along the wall of the tube on top of Lymphocyte Separation Solution following centrifugation at 1200×g for 10 min at room temperature. The supernatant containing mononuclear cells (MNCs) was collected, washed with PBST, and centrifuged at 300×g for 10 min at room temperature. Further, EasySepTM Human CD8+T Cell Isolation Kit (Stemcell Technologies, catalog #17953) was utilized to isolate highly purified CD8+T cells according to the manufacturer’s guidance. The isolated cells were phenotypically identified by flow cytometry using anti-human CD3 antibody, clone UCHT1 (Stemcell Technologies, catalog #60011) and anti-human CD8a antibody, clone RPA-T8 (Stemcell Technologies, catalog #60022). The activity of CD8+T cells was measured by trypan blue staining. CD8+T cells were cultured with ImmunoCult™-XF T Cell Expansion Medium (Stemcell Technologies, catalog #10981) and stimulated with ImmunoCult™ Human CD3/CD28 T Cell Activator (Stemcell Technologies, Catalog #10981).
Bioinformatic analysis
To explore downstream targets of LINC01088, microRNAs expression in CRC tissues were extracted from The Tumor Cancer Genome Atlas (TCGA) dataset. In addition, the relationship between tumor G3BP1 expression and immune infiltration in colorectal cancer was analyzed using Tumor IMmune Estimation Resource (TIMER) (https://cistrome.shinyapps.io/timer/) dataset (Li et al, 2016; Li et al, 2017).
Statistical analysis
Statistical analysis was performed using SPSS 21.0 software. Graphs were made using the GraphPad Prism 8 (GraphPad Software, San Diego, CA). All data were expressed using mean ± standard deviation and data conforming to normal distribution were compared between two groups using two-tailed Student t-test. For multi‐group comparisons, statistical significance was determined by one‐way analysis of variance (ANOVA) followed by Fisher’s Least Significant Difference (LSD) test. Kaplan-Meier method was used to analyze the relationship between gene expression and prognosis of CRC patients. A P<0.05 was considered as statistically significant. *P < 0.05, **P < 0.01, ***P < 0.001, and NS: not significant.