Study sites
The study was carried out in 31 health districts, located in 4 Regions in the forest zone of Cameroon. Thirteen health districts were surveyed in the East, ten health districts were in the Center Region, four health districts each were in the South and Littoral Regions respectively. A total of 124 communities were involved, 4 from each of the 31 health districts. (Figure 1; Supplementary material Figures S1 and S2). These communities are located in the forest area of Cameroon which are breeding sites of different filarial transmitting vectors and MDA has not been introduced in these communities. The survey was conducted from July 2016 to January 2017.
Study Design
This study was a cross-sectional community-based survey. In each community, at least 125 participants both male and female of greater than 5 years, who had been resident in the community for at least 5 years, were recruited and screened during the day for the presence of W. bancrofti using the Alere Filarial Test strip (FTS, Alere, Scarborough, ME, USA). All eligible participants either consented or accented (if below 21years) were recruited for the study. Sociodemographic factors were collected using a structured questionnaire. We used the algorithm shown in Figure 2 to detect the presence of W. bancrofti. Blood samples for FTS testing, thick blood film (TBF) and dry blood spot (DBS) for real time polymerase chain reaction (qPCR) were also obtained. Night blood samples (10:00 pm to 12.30am) was collected from FTS positive individuals for microscopy to detect W. bancrofti microfilariae, and for qPCR.
Circulating filarial antigen test with FTS
Antigen testing was performed with FTS according to the manufacturer’s instructions. In brief, 75μL of finger prick blood collected from eligible participants using non-heparinized microcapillary tubes (soda lime glass, Modulohm A/S Herlev, Denmark) was tested using FTS and the test was allowed to run for 10 minutes before being read. The result was recorded on the data record sheet. Individuals who tested negative on the FTS were informed. Individuals who tested either negative or positive on the FTS were informed of the result and those who were positive asked to return at night between 10:00 PM – 12:30 AM to have additional blood taken for microscopic evaluation of W. bancrofti mf. It was necessary to have the blood taken at night due to the nocturnal periodicity of W. bancrofti mf in the blood. Quality controls for the FTS strip were conducted daily before the exercise, using positive and negative controls from the manufacturer, to ascertain standards and kits performance throughout the study.
TBF for Microscopy
Standardized 50μL of blood was collected with a non-heparinized microcapillary tube to identify mf of W. bancrofti (night blood of FTS positive individuals, between 10:00 pm to 12.30 am) or mf of L. loa (day blood, 8am to 4pm). In brief, the collected 50μL of blood was placed on the centre of a clean slide, and spread repeatedly in a circular area of about 1.5cm using the microcapillary tube. They were air dried and packaged for staining at the base. All blood smears were stained with 10% Giemsa within 24 hours. The stained smears were examined using a light microscope at 10X objective lens (or using 40X objectives lens), for blood dwelling mf. Any mf present were identified based on the the size and presence or absence of a sheath, quantified and recorded.
Whatman dry blood spot (DBS)
For each participant, 6 spots of 50μL of blood were loaded onto Whatman filter paper (GE Healthcare UK Ltd, Little Chalfont, United Kingdom.) to prepare dry blood spots (DBS) for analysis by qPCR. After drying, DBS were kept separately in individual plastic bags at ambient temperatures and was later stored at -80 °C until processed. Given the diurnal periodicity of L. loa mf, sampling was performed between 10:00 AM and 4:00 PM. DBS were also collected for all individuals who were FTS positive during night blood sample collection as described above.
Detection of filarial DNA in DBS by qPCR
DNA was extracted from the DBS, using the QIAGEN DNeasy kit (QIAGEN, Valencia, CA) following the manufacturer’s instructions. Briefly, one DBS of a participant was cut out and placed in a 2ml microtube, covered with 270μL of ATL buffer, incubated at 85°C for ten minutes, then at 56°C for one hour after addition of 30μL of proteinase K. Addition of 300μL of Al buffer to the digested suspension brought up the lysate volume to a total of 600μL. From this step, the lysates were heat-treated (100°C), prior to the DNA purification, to denature the genomic DNA to make the DNA target sequence more accessible to the primers. A volume of ethanol equivalent to half the volume of lysate sample was added before loading the mixture onto a DNeasy spin column. Depending on the volume loaded, additional centrifugations were performed to pass all the solution through the column. After washing, (twice with AW1 buffer, once with AW2 buffer), purified DNA was eluted in 200μL of AE buffer. The qPCR assays for W. bancrofti were performed using 2 μL of DNA and the W. bancrofti-specific long DNA repeat (LDR) primers as described by Rao et al in 2006 [17]. For the detection of W. bancrofti the “long DNA repeat” (LDR) was used as a target. The nucleotide sequences for the forward and reverse primers were LDR 1, 5’ ATTTTGATCATCTGGGAAGGTTAATA 3’ and LDR 2, CGACTGTCTAATCCATTCAGAGTGA3 and the sequence for the probe was /56FAM/ATCTGCCCA/ZEN/TAGAAATAACTACGGTGGAT CTCTG/3IABkFQ. All assays were performed in duplicate using kappa probes master mix kit (Kappa Biosystems, Wilmington, MA) with 20pmol of each primer (LDR1 and LDR2) and 6pmol of LDR probe per well in the final volume of 20 μL and the fast PCR programmed automatically (95°C temperature 40 cycles for 20 seconds, 60°C for 1 second and 72oC for 20 seconds) in a Step-One-Plus PCR system (Applied Biosystems, Foster City). The primers for L. loa PCR were LLMF72, 5’CGGAAGACTCAACGTCAGAAATCA3’ and 5’AGGAACGCTGATGGTGATGT3 and for the probe was /56FAM/CCAACAGCC/Zen/TGCTTT/31ABkFQ. qPCR were performed to identify DNA from L.loa mf as described by Fink et al. [18]. These entire tests were performed with 1 μL of extracted DNA (representing 0.1427 μL of whole blood).
Data management
Data generated either in the field or laboratory were collected using smart phones and uploaded to a center server coded with a password at the end of each day, to prevent accidents or the phones getting bad. The data were compiled and managed using Epi Info version 7.2 (Center for Disease Control and Prevention, Atlanta, GA) and Microsoft Excel 2013. It was checked for missing values and redundancy. All missing values were registered as missing.
After cleaning, the data was re- uploaded to the main server and hard copies in DVDs were also made. All hardware and software carrying the research data can only be accessed by the research team. Security password and server cupboard had been set up to protect the data at the University of Buea/REFOTDE, Buea, Cameroon.
Data Analysis
Data were analyzed using the IBM SPSS Statistics (version 20.0, IBM, Armonk, NY, US). Some descriptive graphs were drawn with MS Excel 2010 and Thematic analysis were performed using the ArcGIS software (version 10.2, ESRI Inc. Redlands, CA, US), to draw the LF map in the 31 health districts and other maps in the analysis (Using GPS coordinates from each study community). The differences across age and gender were tested using fishers statistics and the 95% confidence interval (CI) computed. Chi-square, Mann-Whitney and Kruskal-Wallis tests were also used to compare LF and L. Loa prevalence level, the Geometric mean index of infection between regions and HDs, sex and age groups respectively. To assess the relationship between FTS positivity and L. loa Mf loads, the geometric mean intensity (GMI) of Mf counts was calculated as follows: GMI = (∑log(x+1)/n) ,Where X = the number of Mf per ml of blood in Mf positive individuals, n = the number of mf positive individuals. Spearman rho correlation analysis was carried out between FTS positivity rate and TBF data (L.loa Mf load) at the regional level to find out if there was any relationship. Odds ratios were calculated to quantify the risk of an individual harboring L. loa Mf and testing positive to FTS compared to the risk for an amicrofilaraemic individual. The value was used to quantify the risk or the relation established by the correlation statistics. Logistic regression analysis was used to determine the predictors of FTS positivity. Gender, sex and quantity of L. loa Mf load were cross tabulated with FTS positivity.
Ethical Consideration
Ethical approval for this work was obtained from the Cameroon National ethics committee (CNEC) number 2015/09/640/CE/CNERSH/SP of 16th September 2015. The Administrative approval number D112-244NS/MINSANTE/SG/DLMEP/SDL/PMDTN/PNLO of 11th august 2016, was granted by the Ministry of Public Health of Cameroon. The investigators ensured that this study was carried out according to the current revision of the Helsinki Declaration and Good Clinical Practices regulations and guidelines from the International Conference of Harmonization (ICH-GCP). Moreover, the investigators ensured that all protocol activities were guided by the ethical principles of the Belmont Report, 45 CFR 46, and all its subsections (A, B, C and D). All ethical issues like; handling of withdrawals, benefits and risks, community participant risk with finger prick, biohazard risk to field technicians, risk associated participant confidentiality and test results, reporting adverse events and unanticipated problems, confidentiality, etc, as stipulated in the study protocol were strictly observed . The purpose of the study was explained to the community leaders and the study participants in their local languages at the time of recruitment. Individual informed written consent was obtained from each participant. If a participant was less than 21 years old (the age of majority in Cameroon), written assent and permission were obtained from the study participant and a legal guardian respectively. The data was analyzed and reported to exclude any directly identifiable information in order to maintain the anonymity of the participants.
Clinical Examination
Trained medical personnel recruited for this study, examined all the participants for lymphedema. All males were examined for signs of the limb lymphedema and hydrocele and female for limb lymphedema. The lymphedema cases also underwent night blood collection for circulatory filarial antigen test and thick blood film microscopy.