Study Area
Saint George Lake is located at the Athalassa National Forest Park (ANFP) in Nicosia, the capital city of Cyprus. It is an artificial lake which covers an area of 68,000 m3 with an average depth of approximately 2 m. The ANFP covers an area of 8.5 km2 and it is found between Aglatzia, Strovolos, Latsia, and Geri municipalities; four of the most densely populated locations in Nicosia. Among the most interesting parts of the forest park is Athalassa Lake and Saint-Gorge Lake (Scheme 1) that serve as aquatic life and bird habitats, making them an extremely important biotope for the island. The present study focuses on monitoring of St. George Lake and its treatment during its blooming period in 2019.
Scheme 1. Lakes in the National Forest Park of Athalassa: (A) St. George Lake and (B) Athalassas Lake located at the Athalassa National Forest Park.
Sampling and monitoring
Sampling was performed at a central part of the lake and water was collected from a depth of 0.1-0.2 m below the surface with the use of a 5 L bucket and a rope. Water samples were collected and stored in acid washed polyethylene (PE) bottles for the physicochemical water characterization and treatment purposes, and in glass containers for cyanobacterial genes and cyanotoxins analyses. All samples were stored at 4 – 6 oC in the dark, brought to the laboratory, and processed within 6 hours after sampling to ensure high accuracy and prevent decomposition of the water characteristics.
The monitoring in St. George Lake occurred between February to December 2019 and 10 samples were collected overall (Table 3). The main physico-chemical parameters (pH, conductivity, salinity, total and dissolved nutrients), the content of cyanobacteria and green algae, the presence of genes for main cyanotoxins synthesis, and the cyanotoxins concentration were determined. Samples were also collected during the blooming period for treatment experiments with liquid hydrogen peroxide and hydrogen peroxide releasing granules.
Table 3. Sample number and date of sampling event in St. George Lake.
Sample no
|
Date
|
1
|
25/02/2019
|
2
|
04/03/2019
|
3
|
18/04/2019
|
4
|
12/07/2019
|
5
|
06/08/2019
|
6
|
22/08/2019
|
7
|
09/09/2019
|
8
|
15/10/2019
|
9
|
12/11/2019
|
10
|
09/12/2019
|
Physico-chemical water characteristics analyses
Raw samples were analyzed for total nitrogen (TN) and total phosphorus (TP) while samples filtered through cellulose nitrate membrane filter were analyzed for the dissolved nutrients content (ammonium - NH4+, nitrates - NO3-, nitrites NO2-, and phosphates - PO43-). Nutrients were determined by using Spectroquant® cell test kits (Merck Millipore) equivalent to EPA and APHA standard analytical methods and the Spectroquant® Pharo 300 spectrophotometer (Merck) with method standard deviations ± 0.15 mg/L-N, 0.027 mg/L PO4-P, 0.043 mg/L NH4-N, 0.13 mg/L NO3-N, 0.0027 mg/L NO2-N; respectively. Dissolved inorganic nitrogen was calculated as the sum of dissolved nitrogen ions (NH4+, NO3-, NO2-). Temperature, pH, conductivity, and salinity were measured at the sampling site using the ExStik® portable pH Meter (EXTECH, FLIR Systems).
Algal content and Instantaneous Chlorophyll Fluorescence (FT) and Quantum Yield (QY)
Instantaneous Chlorophyll Fluorescence (FT) and Quantum Yield (QY) were determined using AquaPen AP 110/C (Photon Systems Instruments, Czech Republic) equipped with blue and red LED light emitters to monitor the growth of algae and cyanobacteria in St. George Lake and for evaluating the efficiency of the applied oxidants in the reduction of the photosynthetic activity of treated bloom.
For the characterization of cyanobacterial species in water samples, raw sample was placed directly or after filtration on a microscopy slide and tested under ECLIPSE Ci-L microscope (Nikon) equipped with OPTIKAM Wi-Fi camera (OPTIKA®, Italy). Phytoplankton samples were preserved with Lugol’s iodine solution (2 % final concentration), stored in 4-6 oC under dark conditions and used within 3 weeks.
DNA isolation and PCR amplification
DNA isolation from the biomass collected on cellulose nitrate filters was performed as described by Rogers and Bendich (1994) with minor modifications [32]. Briefly, filters were placed in 2 mL Eppendorf tubes, frozen in liquid nitrogen and grinded. Glass beads were added in ratio 1:1 and the content was dissolved in 700 µL of the extraction buffer I (100 mM Tris, 1.3 M NaCl, 20 mM EDTA, 4% cetrimonium bromide, 1% polyvinylpyrrolidone, 0.1% 2-mercaptoethanol). The mixture was beaten for 10 min using vortex shaker. After 45 min of incubation in 65 °C with 0.5% RNase A, 600 µL of the chloroform-isoamyl alcohol mixture (24:1) was added and the content was shaken and centrifuged at 14000 g for 10 min. The upper phase was transferred into a new tube and mixed with 50 µL of buffer II (10% cetrimonium bromide, 0.7 M NaCl). The chloroform washing step was repeated. After the addition of cold isopropanol in ratio 1:1 the mixture was centrifuged at 14000 g for 10 min. The pellet was washed in 500 µL of 70 % ethanol and the samples were centrifuged at 14000 g for 10 min. The supernatant was discarded, and the pellet was dried on air and resuspended in 50 µL of nuclease-free water.
PCRs for the identification of main genes of cyanotoxins were conducted using Dream Taq DNA polymerase (Thermo Fisher Scientific). Approximately 80 ng of isolated DNA was added to the reaction mixture (20 µl total volume) with 0.2 µM of each primer. PCR was performed with the following parameters: initial denaturation for 3 min at 95 °C, 30 cycles at 95 °C for 30 s, a primer-pair specific temperature for 30 s and 72 °C for 60 s; a final extension at 72 °C for 10 min. The electrophoresis of PCR products was conducted on 1% agarose gels at 100 V for 25-40 min. Gels were stained with Midori Green Advance DNA Stain (ABO).
Table 4. Primers used in the detection of cyanotoxin producing genes in St. George samples and amplification parameters used at PCR.
Targeting gene
|
Primer name
|
Sequence 5’-3’
|
Amplicon size (bp)
|
Annealing temperature (°C)
|
Reference or source of sequence for primers design
|
cyrJ
|
cyrJ_F
|
AGTAATCCCGCCTGTCATAGA
|
109
|
60
|
This study; KY550407.1
|
cyrJ_R
|
ACTGAGCATTGTCTCGGTAAAC
|
cyrB
|
cyrB_F
|
GCCTGAGTACCTATCTGCTTAAC
|
95
|
60
|
This study; EU140798.1
|
cyrB_R
|
AGCCTGAAACTGCTCCATATC
|
sxtA
|
sxtA_F
|
GCGTACATCCAAGCTGGACTCG
|
683
|
55
|
DOI: 10.1128/AEM.02285-09
|
sxtA_R
|
GTAGTCCAGCTAAGGCACTTGC
|
anaC
|
anaC_F
|
TCTGGTATTCAGTCCCCTCTAT
|
366
|
58
|
DOI: 10.1128/AEM.06022-11
|
anaC_R
|
CCCAATAGCCTGTCATCAA
|
mcyB
|
mcyB_F
|
CCTCAGACAATCAACGGTTAGT
|
119
|
60
|
This study; M
MPM020771.1
|
mcyB_R
|
AAAGGCAGAAGGCACCATATAA
|
mcyE
|
mcyE_F
|
CTGGTGGGAAAGGACTGATTTA
|
95
|
60
|
This study; CP020771.1
|
mcyE_R
|
CGCCCTCAAGTCAAGAAAGA
|
HPLC-HRMS
The high-performance liquid chromatography – high-resolution mass-spectrometry (HPLC-HRMS) method was used to check the presence of intra-cellular cyanotoxins in biomass stored on GF/C filters at -20oC until extraction. Sample preparation included extraction of cyanotoxins with 1 mL of 75% methanol in an ultrasonic bath [33]. All chemicals used for analytical procedures were the analytical grades. Acetonitrile (HPLC-grade) and methanol (LiChrosolv hypergrade for LC-MS) were purchased from Merck (Darmstadt, Germany); formic acid (98–100%) was obtained from Fluka Chemika (Buchs, Switzerland). High quality water (18.2 MΩ cm−1) was produced by the Millipore Direct-Q water purification system (Bedford, MA, USA). The MC-LR, MC-RR, MC-YR standards were purchased from Sigma Aldrich. Sample preparation procedures were run according to Chernova et al. (2016). Analyses of extracts were performed using the LC-20 Prominence HPLC system (Shimadzu, Japan) coupled with LTQ Orbitrap XL Hybrid Ion Trap − Orbitrap Mass Spectrometer (Thermo Fisher Scientific, San Jose, USA). Separation of the toxins was achieved on a Thermo Hypersil Gold RP C18 column (100 mm × 3 mm, 3 μm) with a Hypersil Gold drop-in guard column (Thermo Fisher Scientific) by gradient elution (0.2 mL min−1) with a mixture of water and acetonitrile, both containing 0.05% formic acid. Mass-spectrometric analysis was carried out under conditions of electrospray ionization in the positive ion detection mode. The identification of target compounds was based on the accurate mass measurement of [М+Н]+ or [М+2Н]2+ ions (resolution of 30000, accuracy within 5 ppm), the collected fragmentation spectrum of the ions and the retention times. Limits of the detection for different microcystin congeners (2-6 ng L-1) were evaluated in model experiments using standard compounds, natural water and biomass as matrixes.
Experimental set-up for treating cyano-HABs
Experiments on the treatment of Mersmopedia sp. bloom in St. George Lake were performed in 250 mL borosilicate glass containers and the oxidants used for this purpose were liquid hydrogen peroxide and metallic peroxide granules. Hydrogen Peroxide (30%) was purchased from Sigma-Aldrich and diluted to 1000 mg/L for the stock solution. Calcium peroxide (CaO2) and magnesium peroxide (MgO2) granules were provided in the form of IXPER® 70CG and IXPER® Magnesium Peroxide Granules 30MG by Solvay Chimika S.A. (free samples). H2O2 stock solution was added to 250 mL of raw sample from St. George Lake to reach a final concentration of 1, 2, 3, 5 mg/L H2O2; and a quantity of 1, 2, 3 g calcium peroxide and magnesium peroxide granules for treating cyano-HABs. The oxidant concentration was monitored by a colorimetric method as introduced by Sellers et. al (1980) [34]. In brief, 5 mL of sample was filtered through a PVDF syringe filter and immediately reacted with 0.5 mL of titanium oxalate ([C]=50 g/L) and 0.5 mL sulfuric acid (1+17 v/v) (both reagents purchased from Sigma – Aldrich). The absorbance at 400 nm was measured by the Spectroquant® Pharo 300 spectrophotometer in a quartz cuvette and the concentration of H2O2 was quantified based on a calibration curve ranged between 0.5 and 20 mg/L. For determining the efficiency of oxidants on mitigating naturally occurred cyanobacterial bloom (Merismopedia sp.); the FT and QY values in both wavelengths (450, 620 nm) were recorded at 1, 2, 3, 4, 6, 24, 48 h with AQUAPEN as described previously. Physicochemical characteristics such as pH, conductivity, TDS and salinity were measured before and after treatment with the use of ExStick probe (EXTECH).
Data processing and statistical analysis were performed with the use of PRISM®-GraphPad software.