2.1. Clinical studies
2.1.1. Ethics and Patients
During June to October 2019, from the patients referred to the Infectious Diseases Clinic of Rasoul Akram Hospital in Tehran, A total of 200 patients who complained of symptoms such as fever and chills, dizziness and drowsiness, burning when urinating, the strange smell of urine, respiratory problems, muscle and chest pain, cough with yellow, green or bloody mucus were selected and informed consent and ethical approval was received from these patients. The initial diagnosis of the disease in these people was made by the fellow doctor. This study was conducted in compliance with the ethical principles and regulations approved by Rasoul Akram Hospital, Iran.
2.1.2. Diagnosis of disease
According to the fellow doctor, the history of smoking, weakened immune system and history of chronic disease was recorded in individuals. For screening, blood, urine, respiratory samples (bronchial lavage, secretions suction), and chest x-ray were performed according to the fellow doctor's instructions.
2.1.3. Prescribing antibiotics and clinical examination of patients
After diagnosing the infection, the decision about the type of antibiotic to be used to treat the infection was made separately by the fellow doctor based on each individual's symptoms. Prescribed antibiotics include; Ciprofloxacin, erythromycin, chloramphenicol, amikacin, tetracycline, imipenem, tazobactam, ampicillin-sulbactam, kanamycin, ceftazidime, and clistin. After 15 days, the results of controlling or not controlling the disease were recorded by a fellow doctor. A sampling of patients was also performed.
2.2. Laboratory detection
2.2.1. Recovery of bacterial isolates and biochemical tests
From patients who did not recover after antibiotic administration, blood, urine, and respiratory samples were collected in the hospital laboratory, and biochemical tests, including growth on blood agar, McCangi agar, and oxidase, catalase, urease, lysine-decarboxylase, MR-VP, SIM, TSA, Simon citrate and arginine tests were performed.
2.2.2. Detection of resistant bacteria
Initial screening was performed by a physician to diagnose resistant bacteria. Also, sampling was performed on patients who did not recover after antibiotic treatment. After the initial diagnosis of bacteria, an antibiotic susceptibility test was performed by standard disk diffusion method according to CLSI (Clinical and Laboratory Standard Institute) protocol and antibiotic discs of imipenem (IMI, 10 µg), ciprofloxacin (CIP, 5 µg), erythromycin (E, 15 µg), chloramphenicol (C, 30 µg), amikacin (AK, 10 µg), tetracycline (T, 30 µg), clindamycin (CL, 2 µg), kanamycin (K, 30 µg), ceftazidime (CAZ, 30 µg) and cleistine (CO, 5 µg) (MAST, England). Pseudomonas ATCC 27853, Acinetobacter ATCC 17978, and Staphylococcus ATCC BAA-2856 were used as positive controls.
2.2.3. Detection of biofilm-forming bacteria
2.2.3.1. Biofilm detection phenotypic test
According to the method of Mariana et al. [22], Congo Red Agar (CRA) medium was prepared by combining BHI (brain heart infusion broth) (37 g/L), sucrose (50 g/L), agar (10 g/L) and Congo Red indicator (0.8 g/L) and clinical strains of bacteria were cultured on plates containing Congo Red culture medium for 24 hours at 37 °C. Under such conditions, biofilm-producing bacteria form black colonies and other bacteria form red colonies.
2.2.3.2 Biofilm detection genotype test
In this test, after culturing the bacteria, 200 μL of them was added to 96-well sterile polystyrene wells and incubated for 24 hours at 37 °C. 200 μL of 1% violet crystal dye was added to it for staining for 15 minutes and then washed with PBS. After adding 200 μL of 33% acetic acid, absorbance was measured at 570 nm by ELISA Reader Stat Fax2100 (Awareness Technology, Ukraine). In order to investigate by Optical density cut-off (ODc) method, first the standard deviation and mean OD of negative control wells and ODc were calculated according to Formula 1 and OD of the studied wells was classified according to Table 1.
Table 1. Classification of bacteria based on biofilm formation capacity
Biofilm Class
|
Results
|
OD > 4×ODc
|
Strong biofilm
|
2×ODc ˂ OD ≤ 4×ODc
|
Medium biofilm
|
ODc ˂ OD ≤ 2×ODc
|
Poor biofilm
|
OD ≤ ODc
|
Negative biofilm
|
2.2.4. Molecular detection of bacteria and confirmation of the presence of biofilm genes
Initially, DNA extraction from screened resistant bacteria was performed according to the protocol of the DNA extraction kit (Sinaclon, Iran). Also, to detect bacterial densities in clinical specimens, polymerase chain reaction (PCR) method using universal primer and sequence (F: 5'-AGAGTTTGATYMTGGCTCAG-3') and (R: 5'-AGAAAGGAGGTGATCCAGCC-3') used. After determining the microbial density by polymerase chain reaction, the presence of Acinetobacter, Pseudomonas and Staphylococcus as well as the presence of OmpA and PgaB genes were confirmed. The primer sequences used in this study are listed in the Table 2.
Table 2: Sequence of primers used for molecular detection
|
16SrRNA
|
OmpA
|
PgaB
|
Acinetobacter
|
(F:5’-TAYCGYAAAGAYTTGAAAGAAG-3’)
(R:5’-CMACACCYTTGTTMCCRTGA-3’)
|
(F:5’-CGCTTCTGCTGGTGCTGAAT-3’)
(R:5’- CGTGCAGTAGCGTTAGGGTA-3’)
|
(F:5’-AAGAAAATGCCTGTGCCGACCA-3’)
(R:5’- GCGAGACCTGCAAAGGGCTGAT-3’)
|
Pseudomonas
|
(F:5’-CGAGGAGTAGTTTTCCCATGTTCACCT-3’)
(R:5’- CCCGTAGAAATGCCTCGACTTC-3’)
|
(F:5’AGCGTTCGTCCTGCACAAGT-3’)
(R:5’-TCCACCATGCTCAGGGAGAT-3’)
|
(F:5’- GCGTGCTCAAGTGTTCAAGG-3’)
(R 5’- ATTCGCCAGCAACCGAAAAC-3’)
|
Staphylococcus
|
(F:5’- ATCGTTTTATCGGGACCATC -3’)
(R:5’- TCATTAACTACAACGTAATCGTA-3’)
|
(F:5’TATCTGGTGGCGTAACACCTG-3’)
(R:5’-GATGAAGCCGTTACGTTGTTC-3’)
|
(F:5’- AGAACCTACAACTTCAGAACCTGTG-3’)
(R 5’- AA ACCTTTAACCGTAGTTGGCGGTAT-3’)
|
The final volume of the reaction (25 μL) includes: 13 µL PCR master mix (PCR buffer, MgCl2, dNTP, 0.2 units of Taq polymerase), 1 µL forward and reverse primer, 1 µL template cDNA and 9 µL distilled water (Amplicon, Denmark). The PCR cycle program containing 95 °C at 5 min, 94 °C at 1 min, 60 °C at 1 min, and 72 °C at 1 min (35 cycles) and final expansion at 72 °C for 5 min.
2.3. Synthesis, encapsulation and characterization of nanoparticles
2.3.1. Preparation of chitosan nanogels
1 gram of chitosan powder (Sigma-Aldrich, USA) was added to a container containing 1 mL of distilled water and 1 mL of hydrogen chloride (pH=4.5) and mixed for 1 hour using a magnetic stirrer with 800 rpm. It was then centrifuged at 1000 rpm for 5 minutes. Dissolved 50 mg of myristic acid and 100 mg of EDC and NHS in 1 ml of ethanol and then the resulting solution was added dropwise to chitosan for 2 hours. The pH of the reaction was then increased with dilute sodium (0.1 M) to precipitate chitosan nanogels (pH=8.5). Finally, the chitosan nanogel precipitate was separated by centrifugation and washed with ethanol and then distilled water.
2.3.2. Thymol encapsulation in chitosan nanogels
By adding dilute hydrochloric acid, the chitosan nanogel was dissolved and the resulting mixture was sonicated for 30 minutes using an ultrasonic homogenizer. 0.5 mL of 99.9% Thymol essential oil (Plant Therapy, USA) was dissolved in 2 mL of ethanol, and myristate was added dropwise at the same time as chitosan nanogel sonication. The sonication was continued for 15 minutes to encapsulate Thymol essential oil in nanogels.
2.3.3. Characterization and investigation of drug loading in nanoparticles with FESEM, XRD, and FTIR electron microscopy
Determination of particle size and the charge was performed using Dynamic light scattering devices and palladium electrodes of ZetaPals device (Brookhaven Instruments Corp., USA) at a light scattering angle of 90° and at a temperature of 25 °C. The morphology of nanoparticles was investigated using field scanning electron microscopy (FESEM) model MIRA3 (TESCAN, Czech Republic) and XRD model X' Pert Pro (Panalytical, Netherlands). 20 μL of dilute nanoparticle solution was dried on aluminum foil at room temperature and then coated with a layer of gold to conduct electrical conductivity. For FTIR spectroscopy, one percent of each sample was converted to a tablet by potassium bromide and then spectroscopy was performed in the frequency range of 400-4000 cm-1.
2.3.4. Evaluation of encapsulation efficiency and release of encapsulated thymol in chitosan
After the encapsulation of thymol in chitosan nanogels, encapsulation efficiency (EE) was evaluated. Then 1 mL of thymol-based chitosan was centrifuged for 1 hour at 14000 g at 4 °C and then washed with PBS. After determining the amount of encapsulated thymol in each sample by measuring the maximum adsorption of the supernatant at a wavelength of 653 nm, the percentage of encapsulation efficiency was calculated using Formula 2.
Formula 2: EE%= Total amount of initial drug entrapped into the Thymol formulations – amount of free drug in supernatant/ total amount of drug × 100
The process of examining drug release in vitro was performed in a 12 kDa dialysis bag (MWCO). For this purpose, after adding 2 mL of free thymol and 2 mL of thymol encapsulated in chitosan nanogels to the dialysis bag, the whole fraction was placed in 50 mL of PBS solution at different pHs of 3, 5, and 7.4 and gently mixed at 37 °C and 50 rpm. It was then aliquoted at specified intervals and a new environment was added to it. Different kinetic diffusion models were analyzed to evaluate drug release characteristics.
2.4. Investigation of anti-biofilm properties of synthesized nanoparticles
2.4.1. Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC)
To determine the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC), the serial dilution method with three replications in a culture medium was used. Dilutions ranging from 256 to 1 μL/mL of chitosan nanoparticles, Thymol essential oil, and Thymol-based chitosan nanoparticles were added to the 96-well plate well. Then 100 μL of microbial suspension was added to each well and the plates were incubated overnight at 37 °C. One well was selected as blank (empty culture medium), and one well was selected as the positive control (culture medium + standard bacteria). Finally, the turbidity of all wells was measured using the ELISA Reader Stat Fax2100 (Awareness Technology, Ukraine) apparatus at 630 nm. The values of MIC, MBC (the lowest concentration of drugs that inhibit bacterial growth or death, respectively), and subMIC (the highest concentrations of drugs that have no effect on bacterial growth) were determined.
2.4.2. Evaluation of OmpA, and PgaB biofilm gene expression
Genomic RNA was extracted according to the protocol of the RNX-Plus kit (Sinagen, Iran) from bacteria isolated from clinical specimens after treatment with subMIC concentrations of chitosan nanoparticles, Thymol essential oil, and Thymol-based chitosan nanoparticles. Concentrations of 1 to 2 μg of RNA were determined by the Nanodrop Model One C (Thermo, USA) with a light absorption reading at 260 nm. Also, light absorption was measured at 260/230 nm to ensure the absence of contamination and the light absorption ratio for RNA was considered equal to 2. CDNA was constructed from RNA extracted from treated and untreated bacteria according to the YTA Kit Protocol (Yekta Tajhiz, Iran). Quantitative Real-Time PCR test was performed with Mastermix Cybergreen YTA (Yekta Tajhiz, Iran) and 16SrRNA gene as a reference gene. 15 μL of reaction volume consisted of 0.5 μL of cDNA, 0.5 μL of the forward primer, 0.5 μL of back primer, 10 μL of mastermix, and 3.5 μL of double sterile distillation water. The temperature cycle program also included initial denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 20 sec and 60 °C for 40 sec. The final step to draw the Melting Curve was selected from 55 to 95 °C.
2.5. Investigation of antibacterial properties of synthesized nanoparticles
After preparing the Müller Hinton agar culture medium, using a sterile pipette No. 5, made 4 mm deep wells on a plate containing the culture medium and then the suspension of resistant bacteria was cultured on the culture medium surface with a sterile swab. 30 μL of subMIC concentration of chitosan nanoparticles, Thymol essential oil and Thymol-based chitosan nanoparticles were poured into wells and incubated for 24 hours. DMSO and gentamicin were used as negative control and positive control, respectively, and the diameter of the growth inhibition zone was measured.
2.6. Investigation of cytotoxicity of synthesized nanoparticles
HEK 293 cells are widely used in biocellular research due to their reliable growth. Therefore, to evaluate the cytotoxicity and survival rate of synthesized nanoparticles, the MTT tetrazolium salt-based colorimetric method was used on HEK 293 cells. According to the instructions of the DMA500 kalazist kit, cells were cultured in 96-well plates with 2-5 ×104 cells per 100 μL of culture medium and incubated overnight in a CO2 incubator. Then the fresh culture medium was replaced and incubation was performed at 37 °C for 24 hours. Dilutions of 256 to 0.125 μL/mL of chitosan nanogels, thymol essential oil, and thymol-based chitosan nanogels were first dissolved in DMSO and then diluted in a culture medium and added to the cells. After incubation of CO2 at 37 °C for 48 hours, 20 mL of MTT solution (5 mg/mL in the colorless buffer PBS) (Kalazist, Iran) was added to the wells and after 4 hours of incubation, the contents of the wells were drained and 100 μL of DMSO solution was added. The plates were placed on a shaker at 400 rpm for 6 minutes to completely dissolve the formed formazan crystals in DMSO. The color intensity was then read by the ELISA Reader Stat Fax2100 (Awareness Technology, Ukraine) at 570 nm. The cell- free culture medium was used as the blank of the ELISA reader apparatus and the culture medium with the cell without drug was used as the control of the living cell. The percentage of viable cells was obtained from Formula 3.
2.7. Statistical analysis
Statistical analysis in this study was calculated using SPSS software version 16 and the results were subjected to One-way Analysis Of Variance (ANOVA). Also, the expression of target genes between the control and treated samples was calculated by Tukey’s HSD post statistical method.