Cell culture
HEK293 (ATCC; CRL-1573) were cultured in Dulbecco modified Eagle medium (DMEM; Sigma; D5796). SH-SY5Y cells (a gift from Cao Chuanhai, University of South Florida) were cultured in DMEM/ Ham’s F-12 50/50 mix (DMEM/ F-12 50/50; Corning; 10-090-CV). Medium was supplemented with 10% fetal bovine serum (FBS; Seradigm; 1400-500), 2 mM L-glutamine (Corning; 25-005-CI), 100 IU of penicillin-streptomycin (Corning; 30-002-CI), and 100 μg/mL:0.25 μg/mL antibiotic/antimycotic (Corning; 30-004-CI). Serum used for experiments was depleted of extracellular vesicles by ultracentrifugation at 100,000 × g for 20 hours and filtered through a 0.2-μm filter prior to being added to culture medium. At the time of harvest, live cells were counted with an automated cell counter (Cellometer Vision, software version 2.1.4.2; Nexcelom Biosciences) by staining with 0.2% trypan blue (Sigma; T8154) in phosphate-buffered saline (PBS). Total live cell counts were used to derive particles per cell in subsequent nanoparticle tracking analyses.
Primary cortical neuron preparation
All animal procedures were carried out in accordance with the guidelines for the Florida State University Institutional Animal Care and Use Committee (ACUC) and all studies were performed in accordance with the recommendations in the National Institute of Health’s Guide for the Care and Use of Laboratory Animals. Cultures of primary cortical neurons were prepared using a standard procedure. Briefly, cerebral cortices were dissected from postnatal day 0 mice with the aid of a stereo microscope. Isolated cerebral cortices were digested with papain (Worthington Biochemical Corporation; LS003119) for 5 minutes at 37°C. Isolated neurons were seeded on poly-D-lysine-coated plates at a density of 470 cells/mm2 and were cultured in neurobasal A medium (Gibco; A3653401) supplemented with B-27 (Gibco; A3582801), 0.5 mM L-glutamine, and penicillin-streptomycin at 37°C and 5% CO2.
Generation of shRNA constructs
Oligonucleotides targeting ALIX, SDCBP (encoding Syntenin-1), TSG101, HRS, and CD63 genes were constructed using target sequences obtained from the Broad Institute GPP Web Portal. The control scramble sequence was generated using the Invivogen shRNA scramble tool as previously described (62). The oligonucleotides listed below were annealed and ligated using T4 ligase between the Bgl II/Hind III sites of pENTR/pTER+ (Addgene plasmid # 17453, a gift from Eric Campeau & Paul Kaufman). Entry clones were then sequenced for verification, and recombined with the destination vector pLenti X1 Zeo Dest (Addgene plasmid # 17299, a gift from Eric Campeau & Paul Kaufman) using LR recombination (Invitrogen #11791-020) according to the manufacturer’s instructions, and as previously described (62).
ALIX:
GATCCCGCATAATCAAGGCACTGTAAAGTGTGCTGTCCTTTACAGTGCCTTGATTATGCTTTTTGGAAA and AGCTTTTCCAAAAAGCATAATCAAGGCACTGTAAAGGACAGCACACTTTACAGTGCCTTGATTATGCGG.
SDCBP (Syntenin-1): GATCCCTATAGCATACTTGCATCTTTAGTGTGCTGTCCTAAAGATGCAAGTATGCTATATTTTTGGAAA and AGCTTTTCCAAAAATATAGCATACTTGCATCTTTAGGACAGCACACAAAGATGCAAGTATGCTATAGG.
TSG101:
GATCCCGTACGTCTTCTGTCCCGTAAAGTGTGCTGTCCTTTACGGGACAGAAGACGTACTTTTTGGAAA and
AGCTTTTCCAAAAAGTACGTCTTCTGTCCCGTAAAGGACAGCACACTTTACGGGACAGAAGACGTACGG
CD63 (combined for lentivirus production):
GATCCCCAACGAGAAGGCGATCCATAAGTGTGCTGTCCTTATGGATCGCCTTCTCGTTGTCTTTTTGGAAA and
AGCTTTTCCAAAAACAACGAGAAGGCGATCCATAAGGACAGCACACTTATGGATCGCCTTCTCGTTGGG
GATCCCTGGGATTAATTTCAACGAGAAGTGTGCTGTCC TTCTCGTTGAAATTAATCCCATTTTTGGAAA and
AGCTTTTCCAAAAATGGGATTAATTTCAACGAGAAGGACAGCACACTTCTCGTTGAAATTAATCCCAGG
HRS:
GATCCCACGGTATCTCAACCGGAACTAGTGTGCTGTCCTAGTTCCGGTTGAGATACCGTCTTTTTGGAAA and
AGCTTTTCCAAAAAACGGTATCTCAACCGGAACTAGGACAGCACACTAGTTCCGGTTGAGATACCGTGG
Scramble:
GATCCCGAGCTTCGCGATCCAAGATAAGTGTGCTGTCCTTATCTTGGATCGCGAAGCTCTTTTTGGAAA and AGCTTTTCCAAAAAGAGCTTCGCGATCCAAGATAAGGACAGCACACTTATCTTGGATCGCGAAGCTCGG
Lentivirus production and stable cell generation
Lentivirus particles for transduction and stable cell generation were produced in HEK293T cells following lipofectamine transfection of expression plasmids (pLenti CMV TetR BLAST and plenti X1 shRNA plasmids) and packaging plasmids pMD2.G (Addgene; number 12259; a gift from Didier Trono) and PSPAX2 (Addgene; number 12260; a gift from Didier Trono) according to the manufacturer's instructions (Invitrogen, L3000015). Of note, to increase efficiency of the knockdown, lentivirus particles for shRNA constructs targeting CD63 were generated by mixing two expression plasmids, generated by the dual oligonucleotides listed. Medium was collected at 48, 72, and 96 hours post-transfection, centrifuged for 10 minutes at 1,000 × g, filtered through a 0.45-μm filter, and frozen at −80°C until use.
Cells stably expressing shRNA of different genes under the control of a tetracycline-inducible promoter were created by first transducing HEK293 or SH-SY5Y cells with lentivirus particles containing pLenti CMV TetR BLAST (Addgene; number 17492). Stable cells were selected with medium containing 10 μg/mL of blasticidin (Invivogen; ant-bl-1) and then transduced with plenti X1/zeo shHrs, plenti X1/zeo shAlix, plenti X1/zeo shSyntenin, plenti X1/zeo shTsg101, plenti X1/zeo shCD63, or plenti X1/zeo shScramble. Doubly stable cells were selected with medium supplemented with blasticidin (10 μg/mL) and zeocin (200 μg/mL) for 2 weeks.
Transfection
Plasmids containing wild-type human APP (APPWT)(pCAX APP 695) or human APP carrying the Swedish/Indiana mutations (APPswe)(pcAX APP Swe/Ind) were purchased from Addgene (Addgene plasmid #30137 and #30145 respectively) (63). The Vps4a and Vps4a E228Q constructs were generously gifted from the laboratory of Dr. Nicholas Buchkovich (Pennsylvania State University) (44). GFP-tagged APPswe was created by inserting the pCAX APP Swe/Ind plasmid into the pENTR1A-GFP-N2 vector (Addgene #19364) between the Hind III and Ncol restriction sites using T4 ligase. Entry clones were then sequenced for verification, and recombined with the destination vector pQCXIZ CMV/TO DEST destination vector (Addgene #17401) using LR recombination (Invitrogen #11791-020) according to the manufacturer’s instructions, and as previously described (62).
HEK293 stably expressing silent shRNA constructs in 100 mm plates were induced by addition of 1 µg/mL of doxycycline 24 hours before transfection with 5 μg of APP 695 or APP Swe/Ind plasmid using Lipofectamine 3000 transfection kit (Invitrogen, L3000015). Lipofectamine reagents were diluted in Opti-MEM medium (Gibco, 31985-070) and added according to manufacturer’s instructions. Twenty-four hours after transfection, cells were harvested and lysed in RIPA buffer, as previously described (40). Cell-conditioned medium was harvested for extracellular vesicle enrichment.
For experiments involving SH-SY5Y cells, a similar protocol was followed. However, SH-SY5Y cells were seeded in plates coated with poly-lysine according to the Poly-L-Lysine Cell Attachment Protocol (Sigma) to ensure adequate adherence. Twenty-four hours later, cells were induced with 1 µg/mL of doxycycline to promote shRNA expression. To differentiate the neuroblast-like cells into a phenotype resembling mature neuronal cells, serum-containing medium was aspirated 24 hours after induction and replaced with serum-free medium. In addition, 10 µM of all-trans retinoic acid (Sigma, R2625) was added to cells, according to Shipley et al (64) at the time of APP Swe/Ind plasmid transfection 24 hours after induction. Forty-eight hours later, cell-conditioned medium was harvested for EV enrichment, and cell lysates were prepared as described below.
Extracellular vesicle enrichment
Extracellular vesicles were isolated from cell-conditioned medium by modified differential centrifugation involving a polyethylene glycol (PEG) precipitation/concentration step as previously described and extensively characterized (40, 65-67). Briefly, medium was collected and centrifuged serially (500 x g for 5 minutes; 2,000 x g for 10 minutes; 10,000 x g for 30 minutes) to remove larger contaminants, or collect pellets for Figure 1A. To enhance the concentration and yield of small EVs, supernatants following the 10,000 g spin were incubated with a 1:1 volume of 2× PEG solution (16%, wt/vol, polyethylene glycol, 1 M NaCl) overnight. The next day, solutions were centrifuged at 3,214 x g for 1 hour to obtain crude EVs. Pellets were resuspended in phosphate-buffered saline (PBS) before an ultracentrifugation wash at 100,000 x g for 70 minutes. EV pellets following ultracentrifugation were lysed in 2× nonreducing Laemmli sample buffer (4% SDS, 100 mM Tris-HCl [pH 6.8], 0.4 mg/mL bromophenol blue, 20% glycerol) for immunoblot analysis. Alternatively, pellets for nanoparticle tracking analysis were resuspended in particle-free PBS. For further purification and sub-population separation by floatation density gradient, EV pellets following the 100,000 x g spin were instead resuspended in 1.5 mL of 0.25 M sucrose buffer (10 mM Tris [pH 7.4]). Gradients (10-30%) were constructed as previously described in detail (40, 41, 43) using OptiPrep (Sigma, D1556). Following fractionation, densities of gradient separated fractions were estimated by measuring refractive indices of fractions with a refractometer (Refracto 30PX). Samples were then washed in PBS and pelleted again by ultracentrifugation at 100,000 xg for 2 hours. Final pellets were resuspended in particle-free PBS for electron microscopy. A 1:1 solution of strong urea-containing lysis buffer (5% SDS, 10 mM EDTA, 120 mM Tris-HCl [pH 6.8], 8 M urea) with the addition of a protease inhibitor cocktail (Thermo, 78438) was added to samples in fractions 2-6 for immunoblot analysis. EV characterization was performed in accordance with the minimal information for studies of EVs (MISEV) 2018 guidelines issued by the International Society for Extracellular Vesicles (68, 69).
Electron microscopy
Electron microscopy was conducted on EV samples isolated in vesicle-rich fractions of the iodixanol density gradient purification step. Grids were prepared and images were obtained as previously described (70).
Nanoparticle tracking analysis
Nanoparticle tracking was performed using a Malvern NanoSight LM10 instrument, and videos were processed using NTA 3.1 software as previously described (71).
Immunoblot analysis
Whole-cell lysates were prepared by washing cells and then scraping them into cold PBS before pelleting at 1,000 × g for 10 minutes and lysis by radioimmunoprecipitation assay (RIPA) buffer as described previously (40). To prepare all cell and EV lysates run under reducing conditions for SDS-PAGE, additional sample buffer (5×) also containing 0.2 M dithiothreitol (DTT) and 2% BME was added to samples. Equal protein of cell lysates measured by Pierce 660 nm Protein Assay (Invitrogen, 22662) or equal volume of EV samples was loaded into an SDS 10%, 12%, or 15% polyacrylamide gel. Western blot analysis was performed as described (40). Ponceau S stain was used to visualize total protein. Blots were probed using the following antibodies: Alix (Q-19; Santa Cruz Biotechnology, 2171; Cell Signaling), Hsc70 (B-6; Santa Cruz), Tsg101 (C-2; Santa Cruz, 4A10; Genetex), CD63 (TS63; Abcam), Hrs (M-79; Santa Cruz), APP (LN27; Biolegend, 2452; Cell Signaling), Amyloid beta (8243, 2454; Cell Signaling), CD9 (P1/33/2; Santa Cruz, MM2/57; Millipore), Syntenin-1 (S-31; Santa Cruz), Flotillin-2 (H-90; Santa Cruz), GFP (600-101-215; Rockland), CD81 (H-121; Santa Cruz), Calnexin (H-70; Santa Cruz), CD71 (13113; Cell Signaling), APP-CTF (A8717; Millipore) rabbit anti-mouse IgG (Genetex, 26728), rabbit anti-goat IgG (Genetex, 26741), or goat anti-rabbit IgG (Fab fragment) (Genetex, 27171). Blots were imaged using an Image Quant LAS4000 (General Electric) and processed with ImageQuant TL v8.1.0.0 software, Adobe Photoshop CS6, and CorelDraw Graphic Suite X5.
Trypsin treatment of EVs
For experiments in Figure 9C-D, PBS-suspended EVs from cells transfected with APPswe were subjected to trypsin pre-treatment. Vesicles were incubated with 0.25% trypsin EDTA (Corning, 25-053-CI) or PBS with 2.21 mM EDTA (Thermo 1861275) for 20 minutes at 37°C. EVs were then washed with PBS and ultracentrifuged at 100,000 x g to re-pellet the vesicles before lysis with 0.1% SDS and protein quantification. Treated vesicle proteins were analyzed by conventional western blot analysis or dot blot analysis.
Immunofluorescence assay
HEK293 cells stably expressing shRNA plasmids targeting a scrambled control, Alix, or Syntenin-1 were seeded in 6-well plates on square glass coverslips. Cells were induced with 1 µg/mL doxycycline five hours later. Cells were transfected with 2 µg of APP Swe/Ind plasmid DNA using Lipofectamine 3000 (Invitrogen) 20-24 hours after initial seeding. Twenty-four hours after transfection, medium was aspirated, and cells were gently washed with PBS. Cells were fixed on the coverslip in 4% paraformaldehyde for 10 minutes, then washed again in PBS before permeabilization in 0.2% Triton X-100 (in PBS) for 30 minutes at room temperature. A 0.2% Tween solution in PBS was prepared to make PBS-T. Cells were blocked in 5% goat serum/PBS-T for another 30 minutes at room temperature, then primary anti-APP antibody (2452; Cell Signaling) was added for a 3-hour room temperature incubation. Cells were washed with PBS before secondary anti-rabbit antibody in 5% goat serum/PBS-T was added for 1 hour at room temperature, then subsequently washed with PBS, and incubated with DAPI stain (Thermo, 62248) in PBS for 10 minutes. Finally, cells were washed once more with PBS and mounted on a glass slide with mounting medium (4% propyl gallate, 90% glycerol in PBS) for confocal microscopy imaging. Confocal images were taken using a Zeiss LSM 880 microscope with 488-nm and 405-nm lasers and processed using Zen 2.1 Black software.
Primary neuronal cultures at days in vitro (DIV) 9 were stained with an antibody against microtubule associated protein 2 (Map2), a neuronal cell body and neurite marker. Cells were grown on poly-D-lysine-coated glass coverslips and were fixed in 4% paraformaldehyde and 4% sucrose in PBS for 20 minutes at room temperature, then blocked in a PBS solution containing 0.3% Triton X-100 (PBST) and 5% normal goat serum for 30 minutes at room temperature. Cells were then incubated in 1% normal goat serum in PBS containing anti-MAP2 antibody (17490-1-AP, ProteinTech, 1:250 dilution) at 4°C overnight. The next day, sections were washed with PBS 3x 5 minutes, followed by incubation with FITC-conjugated secondary antibody (4050-02, Southern Biotech, 1:1000 dilution) for 2 hours at room temperature. After several washes with PBS, the coverslips were counterstained with 5 µg/mL DAPI (Sigma-Aldrich) in PBS for 5 minutes, washed in PBS for 5 minutes and mounted with Vectashield (Vector laboratories) to retard fluorescence fading. Images of cells were obtained using a Keyence BZ-X710 fluorescent microscope.
Live cell imaging
For subcompartmental localization analysis of APPswe, shRNA-containing HEK293 cells were seeded into 35 mm glass bottom dishes (Greiner, 627860) and induced with doxycycline the next day, as described above. Approximately 4 hours later, cells were transfected with 2 µg of GFP-tagged APP using lipofectamine transfection reagent, and incubated for another 24 hours. Staining with cellular compartment specific stains was performed as follows. Lissamine™ Rhodamine B 1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine, Triethylammonium Salt (rhodamine DHPE; Thermo Fisher; L1392) was used to stain endosomal compartments as previously described (72). Briefly, stock DHPE was dissolved in chloroform for a concentration of 5 mg/mL. One µL of stock was resuspended in 50 µL of cold 95% ethanol, then further diluted 1:600 in cold PBS, before adding 200 µL to cells in a dropwise manner and incubating for 30 minutes. Cells were washed and double stained with Hoechst nuclear stain (5 μg/mL; 62249; Thermo Scientific) before live-cell imaging. LysoTracker™ Red DND-99 (Thermo Fisher; L7528) was used to highlight lysosomal compartments by incubated cells with 75 nM of the LysoTracker stain before washing and adding Hoechst nuclear stain for 30 minutes. For Golgi staining, cells were incubated with CellLight® Golgi-RFP, BacMam 2.0 (15 particles per cell; Thermo Fisher; C10593) 16 hours before washing, staining with Hoechst nuclear stain, and imaging. For ER staining, 1 μM final concentration of ER-Tracker™ Blue-White DPX (Thermo Fisher; E12353) was added to cells for 30 minutes before cells were washed and imaged. To visualize autophagic vacuoles within cells, Mono-dansylcadaverine (MDC; 30432; Sigma) was added to cells at a final concentration of 50 nM for 30 minutes before washing cells and imaging as previously described (66). All images were taken using a Zeiss LSM 880 microscope with 543-nm, 488-nm, and 405-nm lasers and processed using Zen 2.1 Black software.
Neurotoxicity assay
Following growth in neurobasal A medium, primary cortical neurons were treated with 2 µg/mL puromycin, 0.25 µM purified oligomerized amyloid beta (see reactive oxygen species detection methods below), or 20 µg of EVs isolated from respective cell lines by PEG precipitation and subsequent ultracentrifugation wash. Forty-eight hours after treatment, medium was aspirated and cells were scraped into cold PBS and centrifuged at 300 xg for 2 minutes. Cells were resuspended in 100 µL of Annexin V binding buffer containing 0.25 µL Annexin V-FITC and 0.25 µL ViaStain™ propidium iodide (PI) stain (Biolegend, 422201; Biolegend, 640905; and Nexcelom, CSK-0112) then incubated in the dark for 10 minutes. Cells were centrifuged again at 300 g for 2 minutes, and resuspended in 500 µL of Annexin V binding buffer (without stains). Images were taken on a Keyence BZ-X710 fluorescent microscope.
Puncta Analyzer plugin was used as described previously (73) to quantify individual puncta for Annexin V and PI stained cells. Five 10x images per condition were analyzed with a minimum of 200 cells counted per group. With region of interest (ROI) selected as the full 10x image, the Puncta Analyzer plugin was used to analyze Red channel (PI) and Green Channel (Annexin V) following background subtraction (rolling ball radius of 50, without white background). Threshold remained consistent across groups, and the minimum puncta size was set to 4 pixels. Data are displayed as puncta per microscopic field normalized to the total number of neuronal cells per field.
Undifferentiated hiPSC culture and cortical spheroid differentiation
Human iPSK3 cells were maintained in mTeSR serum-free medium (StemCell Technologies, Inc., Vancouver, Canada) on 6-well plates coated with growth factor reduced Geltrex (Life Technologies, Carlsbad, CA) as previously reported (74). The cells were passaged by Accutase dissociation every seven days and seeded at 1×106 cells per well of tissue culture treated 6-well plate (in 3 mL medium) in the presence of 10 μM Y27632 (Sigma) for the first 24 hours (74-76). For neural differentiation, human iPSK3 cells were seeded into Ultra-Low Attachment 24-well plates (Corning Incorporated, Corning, NY) at 3×105 cells/well in 1 mL of differentiation medium composed of Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) plus 2% B-27 serum-free supplement (Life Technologies). Y27632 (10 μM) was added during the seeding and removed after 24 hours. On day 1, the cells formed spheroids and were treated with dual SMAD signaling inhibitors 10 μM SB431542 (Sigma) and 100 nM LDN193189 (Sigma) (74, 76, 77). After 8 days, the cells were treated with fibroblast growth factor (FGF)-2 (10 ng/mL, Life Technologies) and cyclopamine (1 μM, Sigma) until day 24-30. Next day, the spheroids were re-plated to Geltrex-coated plates and grown for 3-5 days before the treatments.
Reactive oxygen species detection
To prepare oligomers of the Aβ42 peptide, biotinylated Aβ42 (Bachem) was fully dissolved at 0.5 mg/mL in hexafluor-2-propanole (HFIP, Sigma) (74, 78). HFIP Aβ(1-42) solution was dispensed at 10 μL into each siliconized Snap-Cap microtube. The microtubes were put in a desiccator to completely evaporate HFIP and thereafter stored at -80°C. Oligomer solutions were prepared freshly for each experiment. The stock was dissolved in 10 μL of DMSO (to 105 μM) and incubated for 3 hours at room temperature. Oligomers of Aβ42 were added to the day 27-35 cortical spheroid cultures at 1 μM, as previous published (74, 78), and incubated for 48 hours before analyzing. EVs (20 μg) harvested from control HEK293 cells, and cell lines expressing APPWT or APPswe in the absence or presence of concomitant shRNA targeting Alix or Syntenin-1 were added to spheroid cultures of the same maturity, then incubated for 48 hours. Reactive oxygen species (ROS) detection was performed using Image-iT™ Live Green Reactive Oxygen Species Detection kit (Molecular probes), as previously described (79). Briefly, the cells were harvested and washed in Hank's Balanced Salt Solution, and incubated in a solution of 25 µM carboxy-H2DCFDA for 30 minutes at 37°C. The samples were then washed and analyzed by flow cytometry. The cultures treated with Aβ42 oligomers were used as the positive control. The cultures that did not receive any treatment were used as the negative control.
Data Analysis and Statistics
Statistical analysis was performed using the GraphPad Prism 8 (GraphPad Software, San Diego, CA) or Microsoft Excel with a significant threshold of p ≤ 0.05. All results are presented as means ± standard error of means (SEMs). The statistical significance of differences between means was assessed using the one-way ANOVA with a post hoc Tukey’s multiple comparison test or student’s t-test. Pearson correlation coefficient (PCC) was determined using an ImageJ colocalization plugin, with a minimum of 10 cells analyzed. Analysis was performed using GraphPad Prism 8 was used to determine significance using a one-way ANOVA with a post hoc Tukey’s multiple comparison test.