1. General information
Sixty-four patients with liver cancer admitted to our hospital from July 2015 to July 2016 were selected as the study group, and another 58 healthy people were selected as the control group for prospective analysis. This experiment has been approved by the Ethics Committee of our hospital. All the above research subjects have signed informed consent forms by themselves or their immediate family members. There was no statistical difference between the two groups in general data such as age, gender and BMI (P > 0.050).
2. Inclusion and exclusion criteria
The inclusion criteria of the study group were as follows: patients were confirmed as primary liver cancer by biopsy of pathology department of our hospital; patients aged 30~60 years; patients with complete case data. Exclusion criteria: patients with other tumors; patients with other cardiovascular and cerebrovascular diseases; patients with other infectious diseases; patients with other autoimmune dysfunction; patients with major organ failure (except the lung); patients with mental disorders; patients received other antibiotics, chemotherapy, radiotherapy and surgery within half a year before admission; patients with low treatment compliance; pregnant and lactating patients; patients transferred to hospital; patients with an estimated survival period ≤1 month. The inclusion criteria of the control group: people with normal physical examination in our hospital; all physical examination results were normal; people with complete cases and no previous major medical history; people aged 30~60 years.
3. Cell data
Human hepatoma cells HepG2, Huh-7, BEL-7402, SMMC-7721 and human normal hepatocyte HL-7702 were all purchased from ATCC cell bank. The cells were cultured in DMEM medium (10% fetal bovine serum +10% penicillin-streptomycin) at 37℃ with 5%CO2, and transfected until the cell coverage rate was 80%~90%. Transfection was performed using Lipofectamine TM 2000 transfection kit (invitrogen, V35113). The procedure was strictly carried out in a sterile environment according to the kit instructions. The cells were cultured in 5%CO2 incubator at 37℃ for 48h, and the culture medium was changed every 6h.
4. Blood and cell sample processing
A 4ml of fasting peripheral venous blood was collected from the two groups, and placed at room temperature for 30min and then centrifuged for 10min (500×g) to obtain upper serum. Total Exosome Isolation Reagent (Thermo Fisher Scientific, 4478360) was added according to the ratio of 1: 5. The serum was mixed thoroughly by shaking and incubated for 30min (4℃). Then the blood was centrifuged for 10min (12000×g), the supernatant was discarded, and the sample was pipetted with PBS buffer. CD63 and CD81 were detected by Western blot, and exosomes were observed under microscope. Cell processing was the same as above. Total Exosome Isolation Reagent was from Thermo Fisher Scientific (4478559).
5. PCR detection
Total RNA in cells was extracted using TRIzol (Invitrogen, 15596018) and Total Exosome RNA & Protein Isolation Kit (Invitrogen, 4478545) was used to extract total RNA in exosomes. The purity and integrity of total RNA were detected by UV spectrophotometer and agarose gel electrophoresis, which required OD260/OD280>1.8 for qPCR detection. CDNA was prepared by reverse transcription (Beijing Tiangen Technology Co., Ltd., FP314), and PCR fluorescence quantification (Applied Biosystems, ABI PRISM 7000) was performed. The primer sequence was designed by Shanghai Lanxuan Biotechnology Co., Ltd. See Table 1. EasyScript One-Step RT-PCR SuperMix kit was purchased from Beijing Transgen Biotech (AE411-02). The test procedure was strictly carried out in accordance with the kit instructions, and a reaction system with a termination volume of 20μL was established. The thermal cycle parameter: 95℃, 5min. Reaction system: denaturation at 94℃ for 30s, annealing at 60℃ for 30s, for a total of 45 cycles.
Table 1: Primer sequence
|
F(5’-3’)
|
R(5’-3’)
|
miR-1290
|
ACACTCCAGCTGGGTGGATTTTTGG
|
CTCAACTGGTGTCGTGGA
|
U6
|
CTCGCTTCGGCAGCACA
|
AACGCTTCACGAATTTGCGT
|
SLU7
|
AGTTAGTGCGACACCCATGAC
|
CAGGAGCATTGCCCAGTTT
|
GAPDH
|
TGACCTCAACTACATGGTCTACA
|
CTTCCCATTCTCGGCCTTG
|
6. Western blot test
The total protein was extracted by RIPA lysis method, the protein concentration was detected by BCA method and adjusted to 4μg/μL, and the protein was separated by 12% polyacrylamide gel electrophoresis. After separation, the membrane was transferred and incubated at 37℃ for 1 hour. Then, it was placed in 5% defatted milk and sealed. SLU7, Caspase 9, E-cadherin, N-cadherin, Bax, Bcl-2, N-cadherin, β-actin primary antibody (1: 1000) were added and incubated overnight at 4℃. PBS was used for rinse for 3 times, goat anti-rabbit secondary antibody (1: 1000) was added, placed at room temperature for 1 hour, and washed with PBS for 3 times. ECL luminescent reagent was developed and fixed, and Quantity One software was used to carry out statistical analysis on the strip scanned by the film, and the relative protein expression level = gray value of the strip to be tested/gray value of β- act in strip.
7. CCK-8 detection
Cells in each group were inoculated into 96-well plates with 1×106 cells/well. Three multiple wells were set in each group. After 24, 48, 72, 96h the cells adhered to the wall, 10μL CCK-8 solution (Beijing Beyotime Biotechnology Co., Ltd., C0037), 0.5mg/mL, was added to each well. After incubation in 37℃ incubator for 2 h, the optical density (OD) value at 450nm wavelength was measured by using an microplate reader, cell proliferation multiples were calculated, and growth curves were visualized.
8. Flow cytometry
Cells to be tested in each group were collected, washed with PBS and then made into a suspension of 1×106 cells/mL with binding buffer. Then Annexin V-FITC (Invitrogen, V35113) dye solution was added, fully shaked and mixed, and incubated at room temperature in dark for 10 min. PI dye solution was added and incubated at room temperature in dark for 5min. Flow cytometer (Beckman Coultert, CytoFLE S) was used for detection.
9. Transwell testing
The cells of each treatment group were digested with pancreatin and inoculated into the 24-well plate of Transwell chamber. A 100μl (density: 1×106 cells /ml) of cell suspension was added to the upper chamber, 250μL of medium containing 10% fetal bovine serum was added to the lower chamber, and cultured for 48h (37℃, 5%CO2). The chamber was taken out, cotton swabs were used to wipe off the cells in the upper chamber of microporous membrane, PBS was used to wash the chamber carefully, 4% paraformaldehyde was used to fix the chamber for 15min, 0.1% crystal violet solution was used to dye for 15 min, PBS was used to wash the chamber for 3 times, and the number of cells passing through the membrane was observed under the microscope.
10. Cell scratch test
Cell suspension with a cell density of 1×106 cells/ml was added to a 6-well plate and cultured overnight until monolayer cells were formed. A horizontal line was drawn on the monolayer cells with a pipette with a volume of 20uL and the exfoliated cells were washed with PBS. Under microscope, the scratch spacing was a. Subsequently, blood-free serum medium was added to continue culturing for 24 hours, and the scratches were examined under a microscope with a spacing of b. The cell mobility =(1-b)/a×100%, 3 fields of view were randomly selected for examination, and the results were averaged.
11. Double luciferase report
After human liver cancer cells were cultured to logarithmic growth phase, pmirGLO-RLU7-WT and pmirGLO-RLU7-MUT vectors were constructed and co-transfected into the cells with miR-1290-mimics and miR-NC respectively. After 48h of transfection, luciferase intensity was detected using double luciferase reporter.
Statistical method
SPSS22.0 (Asia Analytics Formerly SPSS China) was used to analyze and process the data. The counting data was expressed in the form of (%), and chi-square test was used for comparison between groups. The measurement data were expressed in the form of (mean± standard deviation), and the comparison between groups adopted independent sample t test. One-way ANOVA and LSD back testing were used for comparison among groups. The comparison among multiple time points adopted repeated measurement analysis of variance and bonferroni back testing. The diagnostic predictive value was analyzed by ROC curve. The survival rate was calculated by Kaplan-Meier method, and the survival rate was compared by Log-rank test. P < 0.050, the difference was statistically significant.