Study Area
This study was conducted in HIV treatment centers situated in all general hospitals in Kaduna State. Kaduna State Nigeria is one of the 19 northern states of Nigeria and has long been seen as the Major capital of the northern region, and now the capital of the North West. (27) It is ranked 4th by land area and 3rd by population in Nigeria. The state capital was the former capital city of the British protectorate of Northern Nigeria (1923-1966) after Zungeru (1903–1923) and Lokoja (1897–1903). It is made up of some major towns which include: Zaria, Kagoro, Kafanchan, Kachia, Zonkwa, Makarfi and Birnin Gwari. (27) Kaduna State has coordinates of 100 20’N 70 45’ E of Nigeria. It has a total land area of 46,053 km2 and a total population of 6,113,503 according to the 2006 population census of Nigeria. (28) Kaduna State has over 1,000 primary healthcare facilities to cater for every resident - even in the most remote villages or political wards of the state. In addition to these, the government has made efforts to establish General hospitals in each of the 23 LGA headquarters to enhance effective and accessible healthcare for its citizens. These General hospitals have since become treatment centers for HIV anti retroviral therapy all around the state.
The survey recruited 158 discordant couples which amounted to 317 individuals. Kaduna State of Nigeria has 23LGAs and these LGAs were further grouped into three senatorial zones/ strata, out of which three LGAs were finally selected by simple random sampling from each senatorial zone. This stratified sampling technique resulted into 9LGAs from which we got the 317 individuals. These LGAs are: Kaduna north senatorial zone (Kudan, Lere and Soba), Kaduna central senatorial zone (Kajuru, K/north and Giwa), and Kaduna south senatorial zone (Kachia, Jema’a and Kagarko). Discordant couples who declined participation were not included. See Kaduna State Map here
https://drive.google.com/file/d/1eyNtIG3tVZLDOazH8nA88IpbhzWwi7_L/view?usp=sharing
Sample collection
Ethical Consideration and Informed Consent
The study was conducted according to ethical standards for human studies as approved by the research and ethics review committee of the Kaduna State Ministry of Health and Human Services. MOH/ADM/744/VOL.1/913. Informed consent was obtained from all participants to take part in the study, after adequate explanations on the purpose, risk, method and benefit of the research. See link below for ethical clearance
https://drive.google.com/file/d/1_JnIr30XLQWQVNwVoAZLWY39x2cbg-mB/view?usp=sharing
A structured questionnaire containing questions on demography and other required information was issued to all the respondents who were HIV positive, with adequate guidance on how to fill- in their responses correctly, and to invite their HIV negative partners for blood sampling. This took place during group information session (GIS). See link for questionnaire here
https://drive.google.com/file/d/1_uWS7jP01VAPzbf6pmtGcm61afmWKUc6/view?usp=sharing
For each of the couples determined above, blood samples (whole blood) of negative partners were collected by Laboratory staff of haematology department of the hospitals. HIV absence was confirmed using test kits (Rapid BTS, Rapid HIV 1 and 2 Home Test Kit/ DETERMINE). Blood samples were stored in the blood bank of the hospitals at 7oC, and were later transported to DNA laboratory Kaduna in good conditioned ice packs for safe delivery. Further analysis for the presence of CCR5 D32 was conducted for the negative bloods in retrospect of CCR5 primer. Chi Square statistics and SPSS 21 was used for relevant statistical analysis.
Optimization/pooling of blood samples
This involved mixing some of the blood samples together (pooled) in one tube, and running the DNA extraction, PCR, and gel electrophoresis as 1 sample. The gel bands were expected to give a picture of a positive result, should it appear at the end of the main analysis. The optimization was done successfully and kept for future reference.
DNA Extraction
DNA was extracted using Accu prep Genomic DNA extraction kit from Bioneer. 20µl of proteinase K was added to each of 20 clean 1.5ml tubes. 200µl of whole blood was added to each of the 20 tubes containing proteinase K. 200µl of binding buffer (GC) was added to the samples and mixed immediately by vortex mixer. All of the mixture was then incubated at 600C for 10min. 100µl of Isopropanol was added and mixed well by pippetting. After this step, the whole solution was spinned down to get the drops clinging under the lid. The lysate was carefully transferred into the upper reservoir of the binding column tube (fit in a 2ml tube) without wetting the rim. The tubes were closed and centrifuged at 8000rpm for 1min. The tubes were opened and the binding column tubes transferred to new 2ml tubes for filtration (supplied). 500µl of washing buffer1(W1) was added without wetting the rim, and all the tubes closed and centrifuged at 8000rpm for 1min. They were centrifuged again, at 12000rpm for 1min to completely remove ethanol, and check that there is no droplet clinging to the bottom of the binding column tube. The binding column was transferred to a new 1.5ml tube for elution (supplied), 200µl elution buffer added onto binding column tubes, and waited for 1min at RT (15- 250C) until elution buffer was completely absorbed into the glass fibre of binding column tubes. To increase DNA yield, there was a waiting for 5min after adding elution buffer (EL), then the tubes were centrifuged at 8000rpm for 1min. to elute. About 180µl- 200µl was obtained using 200µl Elution buffer (for improved yield, the elution was done twice). The eluted genomic DNA which was visible at the bottom of the tube was then used for PCR.
Polymerase Chain Reaction (PCR)
The PCR was conducted using Accupower Hotstart PCR premix, Bioneer. PCR primers (forward (5′→3′):AGGTACCTGGCTGTCGTCCA;reverse(5′→3′):CTCACAGCCCTGTGCCTCTTC) designed for an amplicon covering the 32 b.p. deletion of the CCR5 D32 with 329 or 297 b.p. in length, respectively was used. PCR- was conducted using the Thermal Cycler Model PTC 100. MJ Research. 2µl DNA extract was added to each of 40 1.5ml tubes. 16µl dH20 was also added to each of the tubes together with 1µl primer forward and 1µl primer backward primers(forward(5′→3′):AGGTACCTGGCTGTCGTCCA;reverse(5′→3′):CTCACAGCCCTGTGCCTCTTC) designed for an amplicon covering the 32 b.p. deletion of
CCR5-Δ32 with 329 or 297 b.p. in length, respectively (Bioneer inc.). The thermal cycler condition was set as follows: Pre- Denaturation- 5min at 950C, Denaturation- 30sec at 940C, Annealing- 30sec at 550C, Extention- 30sec at 720C 35 cycles, Final extention- 5min at 720C. The procedure was repeated for all 159 DNA extracts.
Gel Electrophoresis
The amplified gene was run on a 1.5% Agarose gel. The gel was prepared by weighing 3g Agarose powder and dissolved in 200ml TAE (Triple Acetate Electrolyte). The mixture was heat in a microwave oven until all Agarose was completely dissolved. The solution was allowed to cool in a water bath set at 500C- 550C. A gel casting tray was prepared by sealing ends of gel chamber with transparent selo tape. A 26 number comb was placed in the gel tray. While the gel was cooling, 5µl Ethidium bromide was added to the gel, mixed by shaking round and poured into the gel tray. It was allowed to cool for 30min at room temperature, combs were removed and the gel placed in electrophoresis chamber and covered with buffer (TAE as used previously). 26 DNA extracts and standard Ladder (Bioneer inc.) were loaded onto the gel electrophoresis at 120V for 1hr. The DNA bands were viewed using UV light box (Biorad). The procedure was repeated for all the 159 samples.
Sequencing
The sequencing of CCR5 genes was done using sequencer model ABI 3100. Preparation of sequencing reaction was done in a 2ml tube in groups of 40 tubes each. All reagents were kept on ice while preparing the sequencing reactions. 9µl of dH20 was added into the tube, 9µl DNA extract was also added, 2µl of primers was equally added and 8µl of Bigdye master mix added. All the mix was then put into the sequencing machine. The thermal cycling program was then set at: 960C for 20sec, 500C for 20sec X 30 cycles, 600C for 4min.
Ethanol precipitation: A labeled sterile 0.5ml tube was prepared for each sample into which 5µl stop solution was added. Every one of the sequencing reaction was transferred into the appropriately labeled tube and mixed thoroughly. The stop solution contains 2µl of 3M Sodium acetate, 2µl of 100mM Na2 – EDTA and 1µl of 20mg/ml of glycogen (provided in the kit). 60µl cold 95% (v/v) ethanol from -200C freezer was added and mixed thoroughly. The mixture was immediately centrifuged at 14,000rpm at 40C for 15min. the supernatant was carefully removed with a micropipette leaving a visible pellet. The pellet was rinsed with 200µl 70% (v/v) ethanol from -200C freezer and centrifuged at 14,000rpm at 40C for 2min. The supernatant was carefully removed again with a micropipette. It was then vacuum- dried for 10min. The sample was re- suspended in 40µl of the sample loading solution provided in the kit.
Sample preparation for Loading in to the Sequencer: The re- suspended samples were transferred to the appropriate wells of the sample plate. Each one of them was overlaid with one drop of mineral oil supplied in the kit. The sample plate was then finally loaded into the instrument and the sequencing started. The whole procedure was repeated for different sets until all the 159 samples were sequenced.
All chromographs/sequence plotting as read on the Flinch TV software after sequencing showed base pair readings as homozygous for CCR5 gene.
Phylogenetic analysis
The sequence obtained above was edited using the NCBI bioinformatics data software. Similar sequences were downloaded in FASTA format using BLAST N from the NCBI bioinformatics software. Downloaded sequences were aligned using MEGA 11 alignment software and evolutionary relationship eliminated at 1000 bootstrap.